SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04435
Annotation
integrase_core_domain_protein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 2.962
 

Sequence

CDS
ATGACCAAAGATTATGAGTTAAGTCGCTGCGTGACCATGTTTACGTCAGAAAATAATGACGACTATGACTGCTCTTTACTAACATACAAAGAAGCTGTGACTGGCACCGACAGACGAAATTGGGAGAAGGCGATACAATCTGAAATGGAATCATTACAGAAAAATAACACCTGGGTATTAGTAGACAAGTCAGAAGCCAAAGGACACAAAATACTGTCGAACAAATGGGTATTTCGGATTAAAGATGACGGTACGTACAAGGCTAGATTAGTCGTACGTGGATGCGAGCAGAAAGGAAACCTGGATTTCGAAGACATTTATAGCCCAGTAGTAAGTCAATCTGCATTAAAAACTTTATTAGCAATTGCCGCATCTAAATCTTACTACTTCATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGACTAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAGTCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCCTAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATAATTCTTACTCAGAGATCCTACATAAATGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTCGAAAACCCCACTAGAGAAGACGTTACAAAAGTGAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTATTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGTGACTCGGATTATGCTGGAGACCCATTGACGAGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACTGAAGCCGAGTACATAGCCGCAGCCGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTACAGGAAATAACCGGTTTGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGGTCGAAGCACATAGACGTGCGGTACCATTTTATACATGAACACTTCGTGCATGGATTAATAAATATTAGCTACTGTCCCACAGAAATTCAGTTAGCTGACGTAATGACAAAACCATTGTCAAAAGTAAAATTTGAAAGACACTGTGCAAGATTAATGCATGTATAG
Protein
MTKDYELSRCVTMFTSENNDDYDCSLLTYKEAVTGTDRRNWEKAIQSEMESLQKNNTWVLVDKSEAKGHKILSNKWVFRIKDDGTYKARLVVRGCEQKGNLDFEDIYSPVVSQSALKTLLAIAASKSYYFMTFDIKTAFLYGELSDEVYMKLPVGYETNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVLGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIILTQRSYINDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNLVSRKVENPTREDVTKVKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQEITGLDIKINLHVDNQSSIQLVKSGSFNKRSKHIDVRYHFIHEHFVHGLINISYCPTEIQLADVMTKPLSKVKFERHCARLMHV

Summary

Similarity
Belongs to the terpene synthase family.
EMBL
GBHO01016409    JAG27195.1    GEDC01029908    JAS07390.1    GECL01003258    JAP02866.1    + More
GBHO01040573    JAG03031.1    GBHO01040574    JAG03030.1    GBHO01035865    JAG07739.1    GBHO01006096    JAG37508.1    GBHO01028636    GBHO01028635    JAG14968.1    JAG14969.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    GDHC01005053    JAQ13576.1    GBHO01024362    JAG19242.1    GBHO01031779    JAG11825.1    GBHO01012744    JAG30860.1    GECZ01017843    JAS51926.1    GEZM01048830    JAV76370.1    GGMR01009345    MBY21964.1    GDHC01010945    JAQ07684.1    ABLF02042027    LBMM01009639    KMQ87973.1    GDAI01002967    JAI14636.1    ABLF02043571    ABLF02045585    ABLF02057174    ABLF02063637    ABLF02063640    ABLF02026843    KQ971338    KYB28117.1    JYDM01000512    KRZ81798.1    LBMM01008978    KMQ88491.1    OIVN01002268    SPD02135.1    GEZM01002084    JAV97376.1    OIVN01001729    SPC97049.1    LBMM01012772    KMQ86003.1    GEZM01078128    GEZM01078127    JAV63002.1    OIVN01004910    SPD19931.1    KL367655    KFD60665.1    LBMM01012536    KMQ86167.1    GEZM01013586    JAV92451.1    OIVN01001707    SPC96839.1    OIVN01003897    SPD14257.1    CM003606    KYP68590.1    OIVN01001091    SPC89740.1    OIVN01000183    SPC75833.1    JYDK01000067    KRX78390.1    FJ544857    ACL97387.1    OIVN01001309    SPC92453.1    OIVN01001052    SPC89229.1    OIVN01005024    SPD20514.1    OIVN01000147    SPC75222.1    OIVN01001196    SPC91020.1    OIVN01000116    SPC74628.1    GEZM01017329    JAV90762.1    OIVN01002904    SPD07378.1    GEZM01017328    JAV90763.1    OIVN01004879    SPD19723.1    JYDS01000349    KRZ11769.1    LBMM01003976    KMQ92933.1    JXUM01118474    KQ566190    KXJ70335.1    OIVN01001666    SPC96375.1    OIVN01001890    SPC98658.1    OIVN01005312    SPD21871.1    GEVI01015824    JAU16496.1    OIVN01001669    SPC96464.1    OIVN01001520    SPC94877.1    OIVN01005657    SPD23465.1    OIVN01000557    SPC82046.1    JYDS01000077    KRZ26987.1    KQ484186    KYP36645.1    KQ483417    KYP53032.1    OIVN01003569    SPD12194.1    OIVN01002256    SPD02034.1    JYDU01000007    KRY00737.1    KQ484038    KYP38095.1    CM003607    KYP67664.1    CM003610    KYP63120.1    FJ544854    ACL97385.1    OIVN01000230    SPC76722.1    GEZM01040221    GEZM01040220    JAV80932.1    FJ544851    ACL97383.1    OIVN01004603    SPD18338.1    NCKU01004452    RWS05910.1    KQ483702    KYP42748.1    CM003603    KYP76811.1    KYP76810.1    JYDO01000312    KRZ65659.1    OIVN01006372    SPD31671.1    OIVN01002680    SPD05612.1    JYDH01000102    KRY32233.1    FJ544856    ACL97386.1    KRY32232.1    OIVN01006259    SPD29117.1    OIVN01000823    SPC86071.1    OIVN01005059    SPD20680.1    OIVN01002854    SPD06945.1    OIVN01000036    SPC73022.1    OIVN01002812    SPD06621.1    OIVN01000758    SPC85117.1    JYDJ01000235    KRX39370.1    OIVN01004563    SPD18125.1    JYDR01000237    KRY65040.1    GEHC01000868    JAV46777.1    GDIP01229956    JAI93445.1    GEHC01000867    JAV46778.1   
Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF01397   Terpene_synth
PF03936   Terpene_synth_C
Interpro
IPR013103   RVT_2        + More
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR039537   Retrotran_Ty1/copia-like       
IPR025724   GAG-pre-integrase_dom       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR008949   Isoprenoid_synthase_dom_sf       
IPR005630   Terpene_synthase_metal-bd       
IPR008930   Terpenoid_cyclase/PrenylTrfase       
IPR034741   Terpene_cyclase-like_1_C       
IPR036965   Terpene_synth_N_sf       
IPR001906   Terpene_synth_N       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF48576   SSF48576       
SSF48239   SSF48239       
Gene 3D

Ontologies

Topology

Length:
528
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00914
outside
1  -  528
 
 

Population Genetic Test Statistics

Pi
312.542424
Theta
207.215607
Tajima's D
1.930515
CLR
0
CSRT
0.870606469676516
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号