SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04401
Annotation
PREDICTED:_uncharacterized_protein_LOC105841331_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.006
 

Sequence

CDS
ATGTCTAAAGCCGAACAGGAATGTGAGGATTTTTATGATTTAAATACATACCGCGATAACACAACTGGACGTTACGTCACCGCTTTGCCTTTCTTGAGGTCGCCTACCGCTCTGGGCGATTCTCTTACAACCGCACGTCGCTGTCTGTCGTCACTCGAACGCAGATTTAAGACAAATATCGCTTTAAAAACTGATTACGATGCCGCGATGAGAGATTATCTCGAACGGAACATCATTTCACCCGCACCCGCTCTTACTGATACGAATTATTACGTCATCCCTCACCACGGCATAAGCCGAGAAGACAAACCGCTCCGCATTGTACTGAACGCAACTGCACGATGCATAGATACAAACGTTTCATTGAACGATTGTTTACATTCCGGTCCTAATTTGCAAGCAGACCTAACCGCGATTATTTTAAAATTCAGACTGTTTCCGATTGCTTTAACCGCCGACATCAAACAAATGTTTTTGGCTATAGGCATTCGTGAGGAAGACCGCCGCTTTTTGAATATATTATACAAATTTGACAAAGATGATAACGCGAAAATGTATCATTTTAATCGCGTTTGTTTTGGTCTACGGTGCTCGCCGTACCTTGCTATGAAGACAGTCAAGCGTCTCGCCCGCGATGAAACTGATTTCCCGATCGCTTCAGAAATCGCTAGTGATCATCTTTATATGGATGATCTAGGAGTTTCGGTAGATACGCCCGAGAATGGAATTCAGTTGGCTCATGATTTAATCGAACTATTCAAACGTGGTGGTTTCGACTTAGTTAAATTCGTTAGCAATTCGCCCGAGGTGTTAAAATCGATTCCGCAAGCCAACCGCTTATCTTCAAAAATTGAATTCGACAAAGAGGATAATATGAAGCTCCTAGGTCTAATTTGGTCACCGGTCGAGGATGAATTTTCAATCGCTATTAAATTCAACCCGCAAGCAAAATGTACAAAGCGCCTTATGCTTTCCACAATCGCTAAACTGTGGGACATAAACGGATTTTGTGCCCCTGTCATTTTACACGCAAAATTGTTAATAAAAGCTCTCTGGGTAGCTCAGATTGATTGGGATGCAGAGCCCCCAAGCGACATCTGTGCTGCATGGAAACGCTTTCTTAGTGAACTCCCCGCTCTGCAAGACTTTAAAATACCTCGCTTCGTAGGTATCGTGCCCGAGTCCCGTGTCATACTACTGGGATTTGCGGACGCTTCTGAAAAAGCGATGGGTGCTTCTGTGTATATTTGTGTACAACCAGCTTCCGGACCAAATGAAGTCAATTTAATTGGTGCCAAAAGCAAGGTCGCGCCGCTCAAGGTTATTTCCTTAGCCCGCCTAGAGCTTTGTGCTGCTGTATTATTATCGAAACTGTTTCGATTTGTTATCGACACTGTTTCTCCCCGCTGTCATGTCGACGAAATTTTCGCGTTTACTGATTCGACAGTGACCCTCCATTGGGTTCACTCGTCTCCGCATCGCTTTGATACTTTCATTGCGAACCGCATCGCACAAATACAGAACAACCTTGACCCCAAACACTTCTACCATTGTGAAGGTACGCAGAATCCCAGCGACTGCTTGAGTCGTGGTCTCACACCCGCTCAATTATTGAATCACCCGCTGTGGCTCCATGGCCCCACATGGGCTCGTGATGACGTCCATACATGGCCCATCAACCGCTTCACGTTTGATCCCGCACAAGATGAAAAGATATTAGAGCTCAAAAAACAATCAAATGTCTTCATCACTACAGATGAGACAGAACCCTTTCTCTGTACGCTGGCCAAGCGCGTCTCTTCTTGAAAACTCACCGCCTTTACAATGGCCAATGGGCATAATTGA
Protein
MSKAEQECEDFYDLNTYRDNTTGRYVTALPFLRSPTALGDSLTTARRCLSSLERRFKTNIALKTDYDAAMRDYLERNIISPAPALTDTNYYVIPHHGISREDKPLRIVLNATARCIDTNVSLNDCLHSGPNLQADLTAIILKFRLFPIALTADIKQMFLAIGIREEDRRFLNILYKFDKDDNAKMYHFNRVCFGLRCSPYLAMKTVKRLARDETDFPIASEIASDHLYMDDLGVSVDTPENGIQLAHDLIELFKRGGFDLVKFVSNSPEVLKSIPQANRLSSKIEFDKEDNMKLLGLIWSPVEDEFSIAIKFNPQAKCTKRLMLSTIAKLWDINGFCAPVILHAKLLIKALWVAQIDWDAEPPSDICAAWKRFLSELPALQDFKIPRFVGIVPESRVILLGFADASEKAMGASVYICVQPASGPNEVNLIGAKSKVAPLKVISLARLELCAAVLLSKLFRFVIDTVSPRCHVDEIFAFTDSTVTLHWVHSSPHRFDTFIANRIAQIQNNLDPKHFYHCEGTQNPSDCLSRGLTPAQLLNHPLWLHGPTWARDDVHTWPINRFTFDPAQDEKILELKKQSNVFITTDETEPFLCTLAKRVSSXKLTAFTMANGHN

Summary

EMBL
GAIX01013989    JAA78571.1    GBHO01044644    JAF98959.1    GBHO01044645    JAF98958.1    + More
GBHO01044643    JAF98960.1    GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GALX01004947    JAB63519.1    GDHC01006469    JAQ12160.1    GEZM01085145    GEZM01085143    JAV60187.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    LBMM01012238    KMQ86334.1    GECZ01008071    JAS61698.1    ABLF02008594    GGMR01017890    MBY30509.1    LBMM01012188    KMQ86362.1    GEZM01054766    GEZM01054765    JAV73410.1    ABLF02041863    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    LBMM01010405    KMQ87487.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GDHC01014057    JAQ04572.1    JAV73413.1    LBMM01009496    KMQ88090.1    ABLF02036131    ABLF02041527    ABLF02064049    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GAMC01021577    GAMC01021573    JAB84982.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    LBMM01008464    KMQ88855.1    GGMR01002421    MBY15040.1    GBHO01009080    JAG34524.1    GALX01000776    JAB67690.1    LBMM01010417    KMQ87475.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02025958    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    GBHO01037676    JAG05928.1    ABLF02005684    GGMR01000737    MBY13356.1    LBMM01007770    KMQ89434.1    GDHC01019528    JAP99100.1    ABLF02066034    LBMM01011492    KMQ86800.1    GGMS01010524    MBY79727.1    LBMM01009442    KMQ88136.1    LBMM01011244    KMQ86944.1    LBMM01011245    KMQ86943.1    LBMM01009202    KMQ88311.1    LBMM01011051    KMQ87060.1    GAMC01009674    JAB96881.1    RSAL01001808    RVE40681.1    GBHO01038800    JAG04804.1    ABLF02006304    ABLF02036268    LBMM01009688    KMQ87939.1    LBMM01011283    KMQ86917.1    LBMM01005079    KMQ91831.1    GGMR01005823    MBY18442.1    LBMM01009551    KMQ88039.1    AXCM01013330    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01009888    KMQ87813.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GEBQ01005223    JAT34754.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    GBHO01044316    JAF99287.1    LBMM01012077    KMQ86420.1    GEZM01060254    JAV71154.1    GDHC01018192    JAQ00437.1    JXUM01030959    KQ560903    KXJ80414.1    GGFL01005358    MBW69536.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GBHO01005525    JAG38079.1    GFTR01008874    JAW07552.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF00078   RVT_1
PF05585   DUF1758
PF03564   DUF1759
Interpro
IPR041588   Integrase_H2C2        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR021109   Peptidase_aspartic_dom_sf       
IPR005312   DUF1759       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000727   T_SNARE_dom       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
614
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10405
Exp number, first 60 AAs:
0.0147
Total prob of N-in:
0.00556
outside
1  -  614
 
 

Population Genetic Test Statistics

Pi
157.489785
Theta
17.660038
Tajima's D
-0.857909
CLR
234.457341
CSRT
0.169341532923354
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号