SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04362
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.297 Extracellular   Reliability : 1.523 Mitochondrial   Reliability : 1.039
 

Sequence

CDS
ATGTCTGTGCTGGAGTCATGGTCCAGACGGCTGGCTAATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGTCGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCTCCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGATGCCTGTCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCTCAAAAATAGGAAACGACTTGTCGTTGCCGAATGTTGTGGCATCAATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGCGGCACGTGAAAGACGCACAATCCCGCCACCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MSVLESWSRRLANPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQSLTGHGCFGEFLLRIGAEPTAECHHCGCDLDTAEHTLDACPAWEGWRRVLVSKIGNDLSLPNVVASMLGDDESWKAMLDFCECTISQKEAARHVKDAQSRHRRAGAREADLAQALAL

Summary

Cofactor
FAD
Similarity
Belongs to the FBPase class 1 family.
Belongs to the GMC oxidoreductase family.
EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    LBMM01009501    KMQ88083.1    + More
QOIP01000014    RLU15083.1    LBMM01016102    KMQ84557.1    LBMM01006538    KMQ90523.1    LBMM01005707    KMQ91279.1    QOIP01000009    RLU18544.1    KZ149922    PZC77701.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    KZ150308    PZC71477.1    ODYU01003322    SOQ41921.1    KZ149950    PZC76665.1    KZ149896    PZC78733.1    AB078935    BAC06462.1    KZ150386    PZC71062.1    QOIP01000004    RLU23632.1    QOIP01000060    RLU14687.1    KZ149918    PZC77857.1    AB078931    BAC06456.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    RSAL01000006    RVE54258.1    AB078929    BAC06452.1    LBMM01003001    KMQ94089.1    LBMM01003679    KMQ93242.1    PZC77700.1    ODYU01006757    SOQ48893.1    RSAL01000109    RVE47213.1    LBMM01006909    KMQ90209.1    RSAL01003504    RVE40273.1    LBMM01008861    KMQ88580.1    LBMM01006022    KMQ91008.1    LBMM01009494    KMQ88097.1    GL450953    EFN80213.1    RSAL01000014    RVE53298.1    LBMM01001564    KMQ96079.1    RSAL01000481    RVE41577.1    D85594    BAA19776.1    ODYU01009945    SOQ54696.1    LBMM01006996    KMQ90129.1    LBMM01014132    KMQ85305.1    LBMM01004272    KMQ92618.1    ODYU01005282    SOQ45985.1    LBMM01006954    KMQ90166.1    ODYU01004308    SOQ44039.1    ODYU01006342    SOQ48109.1    LBMM01005733    KMQ91252.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    LBMM01005634    KMQ91349.1    QOIP01000007    RLU20280.1    LBMM01024024    KMQ82631.1    LBMM01006657    KMQ90417.1    ABLF02006132    ODYU01008140    SOQ51495.1    LBMM01008682    KMQ88705.1    QOIP01000002    RLU25407.1    QOIP01000003    RLU25053.1    QOIP01000010    RLU18098.1    ODYU01005115    SOQ45661.1    LBMM01012797    KMQ85990.1    QOIP01000031    RLU14697.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    LBMM01006671    KMQ90407.1    GGMR01011974    MBY24593.1    ODYU01004693    SOQ44845.1    QOIP01000012    RLU16027.1    LBMM01003452    KMQ93523.1    LBMM01004152    KMQ92762.1    QOIP01000013    RLU15211.1    LBMM01032197    KMQ81741.1    GFXV01002090    MBW13895.1    LBMM01004906    KMQ92001.1    LBMM01005672    KMQ91302.1    LBMM01006662    KMQ90413.1    GGMR01010769    MBY23388.1    GGMR01002122    MBY14741.1    LBMM01020326    KMQ83308.1    ABLF02017307    LBMM01006534    KMQ90528.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00316   FBPase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF00732   GMC_oxred_N
PF00650   CRAL_TRIO
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR033391   FBPase_N       
IPR000146   FBPase_class-1       
IPR028343   FBPtase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001251   CRAL-TRIO_dom       
IPR036865   CRAL-TRIO_dom_sf       
IPR036273   CRAL/TRIO_N_dom_sf       
IPR006759   Glyco_transf_54       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF51905   SSF51905       
SSF52087   SSF52087       
SSF46938   SSF46938       
SSF53098   SSF53098       

Ontologies

Topology

Length:
162
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0034
Exp number, first 60 AAs:
0.00268
Total prob of N-in:
0.15590
outside
1  -  162
 
 

Population Genetic Test Statistics

Pi
55.873256
Theta
52.301292
Tajima's D
0.875447
CLR
0
CSRT
0.626618669066547
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号