SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04349
Pre Gene Modal
BGIBMGA000833
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_salivary_glue_protein_Sgs-3-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.202
 

Sequence

CDS
ATGCTACAGGGCACTACTGCGGTGCCACCAACAGTTAAGAGGCTAGTTTTGCAGATCCGGATTACGGAAACGACATCGACTACGACCACTACAACTTCAACAACAAATCCAACAACCACCACTACTTCAACCACTACAACACCAACAACCACTACTACAATACCGACCACAACTACGACCCAAGCAACAACTACAACAACAACTCCTACAACGACTACAACACCTACTACCACTACAACTCCAATAACAACAACTGAAACTACAACCACTACTCCAACCACCACTACAACCCCAACCACGACCACTACAACCCCAACCACGACCACTACAACACCGACAACCACTACAACACCGACTACAACCACTACAACGCCAACTACCACCACTACAACACCGACTACAACCACTACAACGCCAACTACCACCACTACAACACCGACTACAACCACTACAACGCCAACTACCACCACTACAACACCGACTACCACAACAACCCCAACAACGACAACTACAACACCAACAACCACAACAACCACTACAACTACAACAACCACAACACCGTCGACAACAACAACCAAACGTGGTCCAAAACGAGGCCCCCCACATCAAATAGTTGATGGCCACGAGAACCTTTCGTAA
Protein
MLQGTTAVPPTVKRLVLQIRITETTSTTTTTTSTTNPTTTTTSTTTTPTTTTTIPTTTTTQATTTTTTPTTTTTPTTTTTPITTTETTTTTPTTTTTPTTTTTTPTTTTTTPTTTTTPTTTTTTPTTTTTTPTTTTTTPTTTTTTPTTTTTTPTTTTTTPTTTTTPTTTTTTPTTTTTTTTTTTTTPSTTTTKRGPKRGPPHQIVDGHENLS

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
212
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02875
outside
1  -  212
 
 

Population Genetic Test Statistics

Pi
77.395149
Theta
90.836489
Tajima's D
-0.432224
CLR
0.133926
CSRT
0.257887105644718
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号