SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04318
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.131
 

Sequence

CDS
ATGCATGTGATTAGGAGATGTATGGAAATGGTAGTGCAAGGTAGAGAGGGAAGAGGTCGACCGAAGAAGACATGGATGGAGTGTGTGAATGACGATATGAGAGGGAGAGAGGAGCTAATATCGGTTCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGTGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACTGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAAATGTTGACCGGCCATGGTTGTTTTGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCATCACTGCGCGGACCGCGACGAGGATGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGATGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MHVIRRCMEMVVQGREGRGRPKKTWMECVNDDMRGREELISVHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVVRRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEDDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ150308    PZC71477.1    + More
KZ150386    PZC71062.1    AB078935    BAC06462.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    RSAL01000481    RVE41577.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    LBMM01008861    KMQ88580.1    LBMM01009494    KMQ88097.1    GL450953    EFN80213.1    LBMM01006954    KMQ90166.1    KQ460685    KPJ12887.1    LBMM01003679    KMQ93242.1    LBMM01008682    KMQ88705.1    LBMM01006725    KMQ90373.1    LBMM01006671    KMQ90407.1    LBMM01005634    KMQ91349.1    LBMM01019839    KMQ83438.1    QOIP01000010    RLU18098.1    LBMM01019838    KMQ83439.1    LBMM01006657    KMQ90417.1    QOIP01000031    RLU14697.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01008349    KMQ88951.1    LBMM01005733    KMQ91252.1    LBMM01005216    KMQ91703.1    LBMM01015018    KMQ84954.1    LBMM01004505    KMQ92346.1    LBMM01015025    KMQ84953.1    LBMM01004634    KMQ92224.1    LBMM01003245    KMQ93755.1    ABLF02041886    QOIP01000007    RLU20280.1    LBMM01002052    KMQ95336.1    GFXV01003903    MBW15708.1    LBMM01003988    KMQ92922.1    GGMR01012534    MBY25153.1    GGMR01005740    MBY18359.1    LBMM01020849    KMQ83202.1    LBMM01007425    KMQ89740.1    GGMR01011974    MBY24593.1    LBMM01014909    KMQ85000.1    LBMM01002480    KMQ94776.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01014918    MBY27537.1    GGMS01012210    MBY81413.1    GFXV01002242    MBW14047.1    GBHO01002982    JAG40622.1    KMQ94772.1    LBMM01014956    KMQ84982.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF17919   RT_RNaseH_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
375
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.84414
Exp number, first 60 AAs:
11.37166
Total prob of N-in:
0.56174
POSSIBLE N-term signal
sequence
outside
1  -  375
 
 

Population Genetic Test Statistics

Pi
35.23086
Theta
41.465351
Tajima's D
0.90992
CLR
37.228222
CSRT
0.634868256587171
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号