SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04286
Pre Gene Modal
BGIBMGA012647
Annotation
PREDICTED:_lipase_1-like_[Bombyx_mori]
Full name
Lipase      
Location in the cell
PlasmaMembrane   Reliability : 3.652
 

Sequence

CDS
ATGTCGTCGTTCAAAACATTAAAATTAATAAGTGCTCTCGTATTCTTAACATTTAAGCGCGGTGTAGCCACGGAAGACTCGTCCGGGACCGTGGCAAGCTTTTCATCAATAGCTGAAACTCTCGGATACGATTGCGTTGCTCACAGGATCACAACAAAAGACGGTTACATACTCACCCTGTTCAATATACCGGGCAACAAAACCAGGCCGATTTTTTTTATGCACGGATTCGGGGATTCCTCACGCACGTTCATAGTCCGAGGGAACACATCTATGTTGGTATCCGTGGCCAAAGCCGGGTATGACGTGTGGGCCGGGAACATGAGGGGGAATGAATACTCCCGCGACCACGTGACGCTAAACGCAGATATAGACGTCGCGGCCTACTGGAATTTTTCGTACCACGAAGTCGGCGTGTACGATCTGCCCGCCCAAATCGATTACATACTGAACAAGACCCAACAAAATCGACTGAGTGTCATAAGTCATTCCCAAGGAAGCGCCGTATTCTTCGTGCTCTTATCCACTTACCCCGAGTACAATGAAAAGATTCGACCCCTAATAACACTAGGGCCTTTATCATACGCTCAAAATATACGACCTCCAGTTAGATTATTGATTCTAATCGCGCCCGTTTTAGAGGTAATATTCAAGGCATTAAACCAGTACGAGCTGTTTGATAGAACGACGAGACTCATCGTAGAATTGCTTTGCAGTCTCCGACCGTTCGGTAGTGAATTGTGCGAAGCCATACTGCTGAGCACGGCGGGACAAAGCGACGACACGTTCAAAGGAGGATTCGTTCGCACGGTCATAAATTATTACCCGGTGAGCACTTCAGTTAAGAACAGCCTGCACGTTGCCCAAAACAGTAACAGCAGGAGGTTCGCCCAATACGATTACGGTCCGGCGGCGAACATCGCTAGATACGGCAACGCTCTTCCACCGGCTTACGATCTGGACAAAGTGAACTGCAGCGTAGCAATTCTCATGGCCAAAAACGACAAGCTGTCGCCAATCGAAGATAACGTGATGTTAAATAATTCACTGCCTAATGTTGTCGTATATGAGTTTGTTGAACGGAGCCCAATGAATCATTACGACTTCGTGTGGGGCGAAGATATGTATTTGATCTTACATCCGTTTATTTTGAAATTTCTAGAACAGTATCAGTAA
Protein
MSSFKTLKLISALVFLTFKRGVATEDSSGTVASFSSIAETLGYDCVAHRITTKDGYILTLFNIPGNKTRPIFFMHGFGDSSRTFIVRGNTSMLVSVAKAGYDVWAGNMRGNEYSRDHVTLNADIDVAAYWNFSYHEVGVYDLPAQIDYILNKTQQNRLSVISHSQGSAVFFVLLSTYPEYNEKIRPLITLGPLSYAQNIRPPVRLLILIAPVLEVIFKALNQYELFDRTTRLIVELLCSLRPFGSELCEAILLSTAGQSDDTFKGGFVRTVINYYPVSTSVKNSLHVAQNSNSRRFAQYDYGPAANIARYGNALPPAYDLDKVNCSVAILMAKNDKLSPIEDNVMLNNSLPNVVVYEFVERSPMNHYDFVWGEDMYLILHPFILKFLEQYQ

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
Feature
chain  Lipase
EMBL
BABH01038896    KQ460480    KPJ14361.1    BABH01034815    KQ459580    KPI99336.1    + More
JTDY01008561    JTDY01003454    KOB64514.1    KOB69530.1    BABH01043411    GDQN01001224    JAT89830.1    BABH01038893    BABH01038894    AGBW02010690    OWR48036.1    JTDY01007194    KOB65389.1    KQ461196    KPJ06301.1    ODYU01002476    SOQ40012.1    KZ150080    PZC73881.1    BABH01032763    BABH01032765    AK403268    BAM19670.1    BABH01038949    KPI99333.1    AGBW02008642    OWR52889.1    JTDY01002846    KOB70611.1    AGBW02011015    OWR47367.1    GAIX01002709    JAA89851.1    OWR48034.1    NWSH01002215    PCG68894.1    KK852827    KDR15390.1    NNAY01001790    OXU22918.1    KK852673    KDR18742.1    GDHF01022533    JAI29781.1    NEVH01020850    PNF21255.1    LJIJ01000666    ODM95481.1    ADMH02002130    ETN58533.1    PCG68895.1    NWSH01000119    PCG79374.1    AAAB01008820    EAA05393.4    AXCN02000090    GEZM01023396    JAV88411.1    NEVH01009768    PNF32784.1    AK417362    BAN20577.1    APCN01002227    CH963857    EDW76549.2    JXUM01107700    KQ565165    KXJ71265.1    GALX01003535    JAB64931.1    DS231848    EDS36638.1    LJIJ01000475    ODM97066.1    GAMD01001453    JAB00138.1    KQ971338    EFA02315.1    KQ460949    KPJ10406.1    CP012523    ALC39218.1    EAL41497.4    NEVH01014836    PNF27530.1    LNIX01000009    OXA50396.1    NWSH01002126    PCG69082.1    GL887707    EGI70293.1    ETN58534.1    ATLV01011799    KE524723    KFB36142.1    KQ982580    KYQ54457.1    CH480818    EDW52471.1    DS231898    EDS44615.1    AXCM01003911    ADTU01025110    ADTU01025111    ADTU01025112    KZ150291    PZC71579.1    KQ981523    KYN40355.1    JTDY01001637    KOB73274.1    NNAY01001167    OXU24914.1    CH954177    KQS70596.1    JXUM01125660    JXUM01125661    JXUM01125662    KQ566971    KXJ69694.1    EDS36642.1    JXUM01045142    KQ561427    KXJ78623.1    CH933807    EDW12727.1    KRG03395.1    NNAY01001370    OXU24207.1    CH940649    EDW64195.2    KRF81489.1    GGMR01011224    MBY23843.1    EDW64196.1    CH916368    EDW03602.1    EDV59018.1    EDW12736.1    AE014134    AAF52978.1    AGB92892.1   
Pfam
PF00561   Abhydrolase_1        + More
PF04083   Abhydro_lipase
PF12146   Hydrolase_4
Interpro
IPR029058   AB_hydrolase        + More
IPR025483   Lipase_euk       
IPR000073   AB_hydrolase_1       
IPR006693   AB_hydrolase_lipase       
IPR022742   Hydrolase_4       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
1K8Q     E-value=1.7204e-43,     Score=443

Ontologies

Topology

SignalP
Position:   1 - 23,         Likelihood:  0.890765
 
 
Length:
391
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.21269
Exp number, first 60 AAs:
0.01416
Total prob of N-in:
0.01049
outside
1  -  391
 
 

Population Genetic Test Statistics

Pi
206.725898
Theta
171.408547
Tajima's D
0.648126
CLR
240.994151
CSRT
0.56187190640468
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号