SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04282
Pre Gene Modal
BGIBMGA012648
Annotation
Lipase_1_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 3.813
 

Sequence

CDS
ATGTCGTTCAAAACATTCAAATTAATAAGTGCTCTCGTATTCCTAACATTTAAGCGCGGTGTAGCCACGGAAGACTCGTCCGGGACCGTACCAAGCTTTTCATCAATAGCTGAAGCCCTCGGATACGATTGCATTGTTCACACGATCACAACGAAAGACGGTTACATACTCACTCTGTTCAATATACCGGGTAACAAAACCAGGCCGATTTTTTTTATGCACGGATTCGGAGATTCCTCACGCACGTTCATAGTCCGAGGGAACACATCTATGTTGGTATCCGTGGCCAAAGCCGGGTATGACGTGTGGGCCGGGAACATGAGGGGGAATGAATACTCCCGCGACCACGTGACGCTGAACGCAGATATAGACGTCGCGGCCTACTGGAATTTTTCGTACCACGAAGTCGGCGTGTACGATCTGCCCGCCCAAATCGATTACATACTGAACAAGACCCAACAAAATCGACTGAGTGTCATAAGTCATTCCCAAGGAAGCGCCGTATTCTTCGTGCTCTTATCCACTTACCCAGAGTACAATGAAAAGATTCGACCCCTAATAACACTAGGGCCTTTATCATACGCTCAAAACATACGACCTCCAGTTAGATTATTGATTCTAATCGCGCCCGTTTTGGAGGTAATATTCAAGGCATTAAACCAGTACGAGCTGTTTGATAGAACTACGAGACTCATCGTAGAATTGCTTTGCAGTCTCCGACCGTTCGGTGGTGAATTGTGCGAAGCCATACTGCTGAGCACGGCGGGACAAAGCGACGACACGTTCAAAGGAGGATTCATTCGCACGGTCATAAATTACTACCCGGTGAGCACTTCAGTTAAGAACAGCCTGCACGTTGCCCAAAACAGTAACAGCAGAAGGTTCGCCCAATACGATTACGGTCCGGCGGCGAACATCGCTAGATACGGCAACGCTCTTCCACCGGCTTACGATCTGAGCAAAGTGAACTGCAGCGTAGCAATTCTCATGGCCAAAAACGACAAGCTGTCGCCAATCGAAGATAACGTGATGTTAAATAATTCACTGCCTAATGTTGTCGTATATGAGACGTTCTTCATGATATTATCGATCGGCTTACACTTGGCATCAGCAGTGTCCATCCTAGAATATCTATTTAATCTAGATGTAAACGAAAACGAGGATTCCAACTTCAAGGACCTGGTCATTAAATACGGTAAGGAATGCGAAGAGTATCAAGTGGTAACGGAGGATGGTTACATTTTAACTCTCTTCCGTATTCCGGGTGACGTCAATCGACCGGTATTGCTTGTGCACGGCTGTTTTGGTTCTGGGGATTCGTTCATCTTAAGGGGTAAGAAGTCGCTGGCTTACGCTCTAGCTGAGGCTGGCTACGACGTGTGGGTCTGCAACTATAGAGGAACTAAATACAGCAGGAAACATGTCACTGTAGATCCAGATCGTGACGACAAGTTCTGGGATTACAGCTTTGAAGAAATCGGTTACTACGACATGCCCGCGTTCATAGACTTCATCTTGGAGAAGACCGGACAAGCCAAGTTACAGACGATAGGATACTCGCAAGGAGGAACGGTCTTCTACGTAATGGGATCTATCAAGCCAGAATACAACGAGAAAATTAAGGTACTAATTTCCCTTGCGCCGATAGCACACTTTTATCACATCAAAAATCCAGTGACCAGGCTGTTCGAAAACGAATCACGTCTGAGTAACATTATCAATGCTATGGGCAAGGAAGAAATTTTTGGTCCACGATCAGGAGAACGAGCTATGATCGACGCGATTTGCTGGAGTCCGTTGACCGGCTACAAGATCTGTTCTCAGTTCTTATTCGAATTGGTTGGTTACGATGAGGACGAATGCGAACCGAAATTCTATTATAAATTAAAGCATTACGTACCGAATAGCATTTCGAAAAAGAATGTCCAGCATTTACTCCAATTGAGGCGCGGTTTCAATCGATTCGATTACGGGCCGGAGAGGAACCTTGAGGTCTACAACGCGACATCGCCATCGAAATATGATTTGGATAAGGTCAAGATGAAAATTGTTCTGTACGTATCGAAAAACGATAGGTTGTCAACAGTGGAAGATGGCGAAGAACTACGGAATGAGTTCTCTAACGTTGTTGAATTTCGCATCATCGAACGCGACGAATTCAACCATTTAGATTTTATATGGGCCAAAAATATGGATAAATACATTTTCCCGCACATACTTCGAGCCTTGGAGCAATATAACTTCTAA
Protein
MSFKTFKLISALVFLTFKRGVATEDSSGTVPSFSSIAEALGYDCIVHTITTKDGYILTLFNIPGNKTRPIFFMHGFGDSSRTFIVRGNTSMLVSVAKAGYDVWAGNMRGNEYSRDHVTLNADIDVAAYWNFSYHEVGVYDLPAQIDYILNKTQQNRLSVISHSQGSAVFFVLLSTYPEYNEKIRPLITLGPLSYAQNIRPPVRLLILIAPVLEVIFKALNQYELFDRTTRLIVELLCSLRPFGGELCEAILLSTAGQSDDTFKGGFIRTVINYYPVSTSVKNSLHVAQNSNSRRFAQYDYGPAANIARYGNALPPAYDLSKVNCSVAILMAKNDKLSPIEDNVMLNNSLPNVVVYETFFMILSIGLHLASAVSILEYLFNLDVNENEDSNFKDLVIKYGKECEEYQVVTEDGYILTLFRIPGDVNRPVLLVHGCFGSGDSFILRGKKSLAYALAEAGYDVWVCNYRGTKYSRKHVTVDPDRDDKFWDYSFEEIGYYDMPAFIDFILEKTGQAKLQTIGYSQGGTVFYVMGSIKPEYNEKIKVLISLAPIAHFYHIKNPVTRLFENESRLSNIINAMGKEEIFGPRSGERAMIDAICWSPLTGYKICSQFLFELVGYDEDECEPKFYYKLKHYVPNSISKKNVQHLLQLRRGFNRFDYGPERNLEVYNATSPSKYDLDKVKMKIVLYVSKNDRLSTVEDGEELRNEFSNVVEFRIIERDEFNHLDFIWAKNMDKYIFPHILRALEQYNF

Summary

Pfam
PF04083   Abhydro_lipase        + More
PF00561   Abhydrolase_1
PF05648   PEX11
PF12146   Hydrolase_4
Interpro
IPR029058   AB_hydrolase        + More
IPR006693   AB_hydrolase_lipase       
IPR000073   AB_hydrolase_1       
IPR008733   PEX11       
IPR022742   Hydrolase_4       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
1K8Q     E-value=8.24421e-47,     Score=474

Ontologies

Topology

SignalP
Position:   1 - 22,         Likelihood:  0.926054
 
 
Length:
748
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.78603
Exp number, first 60 AAs:
0.00912
Total prob of N-in:
0.03353
outside
1  -  748
 
 

Population Genetic Test Statistics

Pi
140.463873
Theta
154.113516
Tajima's D
1.931796
CLR
1.888209
CSRT
0.871906404679766
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号