SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04281
Pre Gene Modal
BGIBMGA012649
Annotation
PREDICTED:_lipase_3-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.088 Nuclear   Reliability : 1.236
 

Sequence

CDS
ATGATATTTCCGAGTCTGATTTTTAAAATTGCGTTCATTTTACTCGTCGCCTTTTTAAATAAAGTTTCTAATTCACTTATAGACTCACCGATCTTGGAAAGCATTCCAGGAGACATTGCCATTGAACAAAACGATTTCGTAAAATCGTACGGTTTGGATCCGGTAGGGAATTTAGTGTCCATTGAAGTACCCGAAGACGCTAACCTTGATTTCAACGGTCTCGCCAAGAAGTACGGGCATCCGTGCGAAGAGCATTACATCGAGTCAGAGGATGGTTATATCACCAAGTTATTTCATTTACCGGGAGATAAGAAACGGCCGGTACTCATGATGCACGGCATCTTCGATTCTGCCGATACTTTTATCATCAGAGGCAACAGATCAATGGCCATATCCCTCGCGAACACTGGCTACGACGTGTGGGTGGGAAACATGAGAGGAAACAAACATTCCCGGAGACACGTTACTCTGAATCCCGACAAAGATCCTGAATTTTGGAACTTCAGTTACCACGAAATGGCGTTGTACGATCTACCTGCGACTATCGACTACATCCTGGGTCACACCGGCCAGACACGGATCTATGGTATCGGTCATTCCCTGGGCAACAATATTTTCTTTGCAATGACGTCAATGTTGCCACAATATAACAAAAAAATCAGGATTTTCATTTCGTTAGCACCGGCTGTTCACCTTGACAATATTAAATTGCCGACAAGAATACTGGCTGTGCTATCTCCCCTTAACAACTATTTGTTGAAAGGTACTGGGCAAGAGGAAATACTTGCGGATTCAACCATCCTGTTTAAAATTTTACGAAAAGTTTGTCCGATTGGTCTGCCTGGATATATTTTATGCGCTGAATTGATTATATTTTACATAGGTGGCTACGATAGGGCAGAACTAGAGCGTGAATTCTTGCCGGTCGTTATAGGTCATGTTACCAGTGGTACCTCAAGGAAAAACTTCATTCACTTGGCGCAGTCGGTGGGAGATGGGTCGGTGGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTACCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAACGCAAAGCTGTCGCGGCCGACGAAGTGTCGGAAATGGCCCGACGCGCTCGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTTAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCTGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCAAGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTACTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTAGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGACGCCACCGGACTCGGCGTGGCCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGAGCATCGAGATGCACTATTTCAGCTGA
Protein
MIFPSLIFKIAFILLVAFLNKVSNSLIDSPILESIPGDIAIEQNDFVKSYGLDPVGNLVSIEVPEDANLDFNGLAKKYGHPCEEHYIESEDGYITKLFHLPGDKKRPVLMMHGIFDSADTFIIRGNRSMAISLANTGYDVWVGNMRGNKHSRRHVTLNPDKDPEFWNFSYHEMALYDLPATIDYILGHTGQTRIYGIGHSLGNNIFFAMTSMLPQYNKKIRIFISLAPAVHLDNIKLPTRILAVLSPLNNYLLKGTGQEEILADSTILFKILRKVCPIGLPGYILCAELIIFYIGGYDRAELEREFLPVVIGHVTSGTSRKNFIHLAQSVGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVSASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVASTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRITGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVAWVRCPVASAKKIALSGRLLSIEMHYFS

Summary

Uniprot
ProteinModelPortal
PDB
1K8Q     E-value=3.49104e-37,     Score=392

Ontologies

GO

Topology

SignalP
Position:   1 - 25,         Likelihood:  0.910572
 
 
Length:
861
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
7.24407999999999
Exp number, first 60 AAs:
2.18553
Total prob of N-in:
0.11272
outside
1  -  861
 
 

Population Genetic Test Statistics

Pi
228.221086
Theta
168.012322
Tajima's D
0.465319
CLR
0.996472
CSRT
0.508324583770811
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号