SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04280
Pre Gene Modal
BGIBMGA012647
Annotation
PREDICTED:_lipase_1-like_[Bombyx_mori]
Full name
Lipase      
Location in the cell
PlasmaMembrane   Reliability : 3.78
 

Sequence

CDS
ATGTCGTTCAAAACATTCAAATTAATAAGTGCTCTCGTATTCCTAACATTTAAGCGCGGTGTAGCCACGGAAGACTCGTCCGGGACCGTACCAAGCTTTTCATCAATAGCTGAAGCCCTCGGATACGATTGCATTGTTCACACGATCACAACGAAAGACGGTTACATACTCACTCTGTTCAATATACCGGGTAACAAAACCAGGCCGATTTTTTTTATGCACGGATTCGGAGATTCCTCACGCACGTTCATAGTCCGAGGGAACACATCTATGTTGGTATCCGTGGCCAAAGCCGGGTATGACGTGTGGGCCGGGAACATGAGGGGGAATGAATACTCCCGCGACCACGTGACGCTGAACGCAGATATAGACGTCGCGGCCTACTGGAATTTTTCGTACCACGAAGTCGGCGTGTACGATCTGCCCGCCCAAATCGATTACATACTGAACAAGACCCAACAAAATCGACTGAGTGTCATAAGTCATTCCCAAGGAAGCGCCGTATTCTTCGTGCTCTTATCCACTTACCCAGAGTACAATGAAAAGATTCGACCCCTAATAACACTAGGGCCTTTATCATACGCTCAAAACATACGACCTCCAGTTAGATTATTGATTCTAATCGCGCCCGTTTTGGAGGTAATATTCAAGGCATTAAACCAGTACGAGCTGTTTGATAGAACTACGAGACTCATCGTAGAATTGCTTTGCAGTCTCCGACCGTTCGGTGGTGAATTGTGCGAAGCCATACTGCTGAGCACGGCGGGACAAAGCGACGACACGTTCAAAGGAGGATTCATTCGCACGGTCATAAATTACTACCCGGTGAGCACTTCAGTTAAGAACAGCCTGCACGTTGCCCAAAACAGTAACAGCAGAAGGTTCGCCCAATACGATTACGGTCCGGCGGCGAACATCGCTAGATACGGCAACGCTCTTCCACCGGCTTACGATCTGAGCAAAGTGAACTGCAGCGTAGCAATTCTCATGGCCAAAAACGACAAGCTGTCGCCAATCGAAGATAACGTGATGTTAAATAATTCACTGCCTAATGTTGTCGTATATGAGTTTGTTGAACGGAGCCCAATGAATCATTACGACTTCGTGTGGGGCGAAGATATGTATTTGATCTTACATCCGTTTATTTTGAAATTACTAGAGCGGTATCAGTAA
Protein
MSFKTFKLISALVFLTFKRGVATEDSSGTVPSFSSIAEALGYDCIVHTITTKDGYILTLFNIPGNKTRPIFFMHGFGDSSRTFIVRGNTSMLVSVAKAGYDVWAGNMRGNEYSRDHVTLNADIDVAAYWNFSYHEVGVYDLPAQIDYILNKTQQNRLSVISHSQGSAVFFVLLSTYPEYNEKIRPLITLGPLSYAQNIRPPVRLLILIAPVLEVIFKALNQYELFDRTTRLIVELLCSLRPFGGELCEAILLSTAGQSDDTFKGGFIRTVINYYPVSTSVKNSLHVAQNSNSRRFAQYDYGPAANIARYGNALPPAYDLSKVNCSVAILMAKNDKLSPIEDNVMLNNSLPNVVVYEFVERSPMNHYDFVWGEDMYLILHPFILKLLERYQ

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
Feature
chain  Lipase
EMBL
BABH01038896    KQ460480    KPJ14361.1    BABH01034815    KQ459580    KPI99336.1    + More
JTDY01008561    JTDY01003454    KOB64514.1    KOB69530.1    BABH01043411    BABH01038893    BABH01038894    GDQN01001224    JAT89830.1    JTDY01007194    KOB65389.1    AGBW02010690    OWR48036.1    ODYU01002476    SOQ40012.1    KQ461196    KPJ06301.1    KZ150080    PZC73881.1    BABH01032763    BABH01032765    BABH01038949    AK403268    BAM19670.1    KPI99333.1    AGBW02008642    OWR52889.1    JTDY01002846    KOB70611.1    AGBW02011015    OWR47367.1    GAIX01002709    JAA89851.1    OWR48034.1    NWSH01002215    PCG68894.1    GEZM01023396    JAV88411.1    NNAY01001790    OXU22918.1    KK852827    KDR15390.1    PCG68895.1    KK852673    KDR18742.1    LJIJ01000666    ODM95481.1    NEVH01009768    PNF32784.1    ADMH02002130    ETN58533.1    NEVH01020850    PNF21255.1    GDHF01022533    JAI29781.1    JXUM01107700    KQ565165    KXJ71265.1    NEVH01014836    PNF27530.1    GALX01003535    JAB64931.1    AK417362    BAN20577.1    LJIJ01000475    ODM97066.1    AAAB01008820    EAA05393.4    LNIX01000009    OXA50396.1    AXCN02000090    CH963857    EDW76549.2    APCN01002227    DS231848    EDS36642.1    DS231898    EDS44615.1    NWSH01002126    PCG69082.1    KQ971338    EFA02315.1    AXCM01003911    CP012523    ALC39218.1    KQ460949    KPJ10406.1    JXUM01045142    KQ561427    KXJ78623.1    GL887707    EGI70293.1    NWSH01000119    PCG79374.1    GEDC01029317    GEDC01024313    GEDC01024096    GEDC01020251    JAS07981.1    JAS12985.1    JAS13202.1    JAS17047.1    JXUM01125660    JXUM01125661    JXUM01125662    KQ566971    KXJ69694.1    KQ982580    KYQ54457.1    CCAG010008921    CH933807    EDW12727.1    KRG03395.1    CH954177    KQS70596.1    EDS36638.1    KQ981523    KYN40355.1    GAMD01001453    JAB00138.1    JXJN01010151    JXJN01010152    JXJN01010153    JXJN01010154    GL761642    EFZ23043.1    ADTU01025110    ADTU01025111    ADTU01025112    CH480818    EDW52471.1    ETN58534.1    CH940649    EDW64195.2    KRF81489.1    JTDY01001637    KOB73274.1    GANO01002781    JAB57090.1    EDV59018.1    ATLV01011799    KE524723    KFB36142.1    NNAY01001167    OXU24914.1    EDW64184.1    KRF81481.1    CH916368    EDW03599.1    EDW64196.1   
Pfam
PF00561   Abhydrolase_1        + More
PF04083   Abhydro_lipase
PF12146   Hydrolase_4
Interpro
IPR029058   AB_hydrolase        + More
IPR025483   Lipase_euk       
IPR000073   AB_hydrolase_1       
IPR006693   AB_hydrolase_lipase       
IPR022742   Hydrolase_4       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
1K8Q     E-value=3.02335e-43,     Score=441

Ontologies

Topology

SignalP
Position:   1 - 22,         Likelihood:  0.926054
 
 
Length:
390
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.22055
Exp number, first 60 AAs:
0.00664
Total prob of N-in:
0.01051
outside
1  -  390
 
 

Population Genetic Test Statistics

Pi
2.836442
Theta
6.067833
Tajima's D
-1.49831
CLR
138.475359
CSRT
0.055847207639618
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号