SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04270
Annotation
transposase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.255 Mitochondrial   Reliability : 1.502
 

Sequence

CDS
ATGACCGTATTTATGTTCAAAGCTCTAAAGAAGCTTAGATTAGTCGACAGAGTGCAACGTGGGCACTATCCGACTTCAGTGATGGTTTGGTGGGGTATTAACTATGAAGGAGTGACTGAGCCATACTTTTGTGAAAAAGTTATCAAAACATCGGCACAAGTGTATCAAGATACCATTCTTGAGAAGGTAGTGAAGCCCCTTAACAACACCATGTTCAATAATCAAGAATGGTCCTTCCAGCAAGACTCGGCGCGAGGTCATAAAGCTCGGTCTACGCAGACTTGGTTGGAAACGAACGTTTCGGACTTCATCAGAGCTGAAGACTGGCCGGCGTCTAGTCCCGATCTTAATCCGCTGGATTATGATTTATGGCCAGTTTTAGAGAGTACGGCTTGCTCTAAACGCCATGATAATTTGAAGTCCCTAAAACAATCCGTACTATTGGCAGTGAAAAAATTTCCCATGGAAAGAGTGCGTGCTTCTATTGATAACTGGCCTCAACGTTTAAAGGACTGTATTGCAGCCAATGGAGACCACTTCGAATAA
Protein
MTVFMFKALKKLRLVDRVQRGHYPTSVMVWWGINYEGVTEPYFCEKVIKTSAQVYQDTILEKVVKPLNNTMFNNQEWSFQQDSARGHKARSTQTWLETNVSDFIRAEDWPASSPDLNPLDYDLWPVLESTACSKRHDNLKSLKQSVLLAVKKFPMERVRASIDNWPQRLKDCIAANGDHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
U47917    AAB47739.1    JF779677    AEO90418.1    AF461149    AAN06610.1    + More
AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB363028    BAG15927.1    AB473770    BAH20555.1    AB363018    BAG15926.1    ODYU01006378    SOQ48174.1    RSAL01000012    RVE53510.1    LNIX01000030    OXA41211.1    RSAL01000114    RVE46946.1    UYSL01019905    VDL71189.1    RSAL01000174    RVE45058.1    JARK01001411    EYC06502.1    JOJR01000015    RCN51257.1    JOJR01000583    RCN36166.1    CAVP010059404    CDL95787.1    JARK01001601    EYB87313.1    KA646003    AFP60632.1    CH902625    KPU75512.1    KX931010    APL98300.1    PDUG01000012    PIC13506.1    KN728435    KIH63782.1    JARK01001337    EYC34439.1    HE601413    CAS00486.1    UZAH01001595    VDO19836.1    RSAL01000021    RVE52408.1    UZAH01026445    VDO80847.1    JARK01000059    EYC44525.1    CAVP010058332    CDL94449.1    UZAH01000669    VDO19161.1    JARK01000176    EYC41234.1    JARK01001345    EYC27589.1    PDUG01000005    PIC28734.1    PDUG01000006    PIC20538.1    UYSL01009772    VDL68385.1    RSAL01000063    RVE49524.1    KN728607    KIH63514.1    DS268433    EFO97645.1    DS268612    EFO94085.1    DS268747    EFP00909.1    DS268492    EFP11674.1    JARK01001658    EYB84158.1    UYSL01022144    VDL79905.1    UZAH01031030    VDP13493.1    DS268428    EFO94379.1    JARK01001418    EYC05389.1    DS268606    EFO93488.1    UYSL01021399    VDL78127.1    DS268508    EFO83264.1    DS268420    EFO87874.1    DS268679    EFO98285.1    DS268466    EFP06959.1    DS268421    EFO88618.1    DS268673    EFO98001.1    PIC23776.1    EFP11689.1    DS268539    EFO88027.1    PIC29926.1    PDUG01000001    PIC51673.1    DS268525    EFO85497.1    KN769991    KIH46151.1    PDUG01000004    PIC32571.1    JARK01000255    EYC39473.1    UZAH01025744    VDO69727.1    CH902666    KPU74611.1    DS268545    EFO88382.1    KI662043    ETN73029.1    DS268565    EFO90304.1    PIC31069.1    UYSL01019770    VDL69590.1   
Pfam
PF00019   TGF_beta        + More
PF13358   DDE_3
PF00431   CUB
PF00292   PAX
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR038717   Tc1-like_DDE_dom       
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR036388   WH-like_DNA-bd_sf       
IPR001523   Paired_dom       
IPR036906   ATPase_V1_fsu_sf       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF49854   SSF49854       
PDB
5CR4     E-value=1.68927e-06,     Score=119

Ontologies

Topology

Subcellular location
Secreted  
Length:
181
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0217
Exp number, first 60 AAs:
0.0217
Total prob of N-in:
0.07423
outside
1  -  181
 
 

Population Genetic Test Statistics

Pi
42.228364
Theta
35.058593
Tajima's D
0.632121
CLR
0
CSRT
0.558822058897055
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号