Gene

KWMTBOMO04259  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA014236

Annotation

PREDICTED:_myosin-IA_[Papilio_xuthus]

Location

Bomo_Chr8(-):1226046-1239159      View in EpiBrowser

Full name

Unconventional myosin ID      

Alternative Name

Brush border myosin IA
Myosin 1D
Myosin-IA

Location in the cell

Mitochondrial   Reliability : 2.032

CDS

ATGCTCCTTTTATTCCAGGGCAGGGACACGTGCGTCCTTATATCGGGTGAATCAGGTGCAGGCAAAACTGAGGCATCTAAATTCATAATGAAGTACATCGCTGCGAACACAACACAAGTACACAGGGAATATATTGACAGAGTGAAAAACGTGTTGATACAGTCAAATACCATACTCGAAACATTTGGCAACGCAAAAACAAATCGCAACGATAATTCGTCCCGTTTCGGCAAATACATGGACATACATTTCGATTATAAGGGCGACCCAGTCGGCGGACACATCAGCAACTACCTCTTGGAGAAAAGTAGAGTGGTCAGCCTTCAACCGGGCGAGAGAAACTTTCATTCGTTTTATCAGCTCCTCAGTTCAAACAATCCGGTTTTGAAAAAACTGGGAATGTCAACGAACACGGCCTACAAGATCCTGGGCAGCGAAAGACCTACAGCGCACGATTCTAAACTTTATTCCCAAACGAATAGTGCGTTTAATGCTCTGGGCTTCTCTAATTCGGTCATCGAGGATATATGGAATATTGTCGCCGGTGTTATTTTATTGGGCGAGGTGACGTTCGAGGGCGGGGAGGGCGGGGAGGAGGGCGGCGCCGTGGCGGCGGGCGCGGTGGCGGGCGCGGTGCGTGCGCTGGGCGTGGCGGAGGCGGGGCTGCGCGCCGTGCTGGGGCGCCGCGTGCTGGCCGCCGGGCACGACCTGGTCACCAAGCAGCACTCGCTCGTGGACGCGCACTACACCAGGCTGGCGCTGGCCAAGGCGGCCTACGACAGACTCTTCACCTGGATCGTGCAACAGATAAACAAAGCCATCGACGTCCCGGCCGGCACGTACAAGAACACCCTCATCGGCGTGCTCGACATCTACGGGTTCGAGATCTTCGAGACCAACAGCTTCGAGCAGTTCTGCATCAACTACTGCAACGAGAAGTTGCAGCAGCTCTTCATCGAGCTGGTGCTGAAACAAGAGCAAGAGGAGTACGCGCGCGAGGGCATACAGTGGACGCCGGTGCAGTACTTCAACAACAGGATCATCTGCGAGCTCATCGACGCGCCCCATCACGGCGTCATCGCCATCATGGACGAGGCCTGCCTCAACCCCACACAGATCACGGACCAGCAGCTGCTGGAGGCGATGGACAAGCGGCTGACCGGCCACCGCCACTACACGTCTCGGCAGCTGGCGCCGACTGACAAGAAACTCAAGCACGGAGTCGACTTCAGGATAACGCACTACGCCGGCGACGTGACGTACGCCATCACCGGCTTCATGGACAAGAACAAGGACTCGCTGTGGCAGGACCTCAAGAGGCTGCTGCACTCCTCCAGCAACGCCTCGCTGGCCGCCATGTGGCCCGAGGGCGCCGCCGACATACAGAAGACCTCCCGGCGCCCCCCCTCCGCCGCGTCGCTGTTCCGCTCGTCGCTGGCGGCGCTGGTGGCGGGGCTGCACTCCAAGGAGCCCTTCTACGTGCGCTGCCTCAAGCCCAACCCCCTGCAGGCGCCCTCCACCTGGGACCCCCTGCTGGTGCAGCACCAGACGGCGTACCTGGGGCTGGTGGAGAACGTGCGCGTGCGACGGGCGGGGTTCGCGTGCCGCGTGCGCTACGACCGCTTCGTGCAGCGCTACAAGATGTTGTCGCAGTACACGTGGCCCAACTACCGCGGACACTCGCCCCGGGACGCCGCCGCCGTGCTGCTGCGGGACCTGCGCCTGGACGACGTGCACTACGGACACACCAAGCTCTTCATCAGGAGTGCTAAAACGCTGCAAAGCCTAGAGGCGGCCCGCGCAGAACTGATTCCTTCCATCGTGGTGCTGCTGCAGAAGTTGTGGCGAGGAGCGATCGCCAGGAGGAGATACAAGAAGATGAAGGCCGCACTAACCATATTCAACGCTTGGAAACGCTACCGCTACCGGCGCTACATCTCGGAGCTGCAGACGGAGCTGTCCCGGCACCGCGGCGTCATCCGGCGCTGGCCCCCCGCGCCGCGCGGCCTGGACCCCGCGCTGCTGGTGGCGGCGTACCGGCGGTGGCGCGCCTACCTCGTGCTGCGCGCCGTGCCGCGGGAGCGCTGGGCCGAGCTGCGCCTCAAGGTGTGCTGCGGCGCGGCGCTGCGGGGGCGGCGGCGGCACTGGGGCGCGGCCCGGCCGTGGCGCGGGGACTACCTGGCCGCGCCCGACTACAACGAGAAGGCGGGAGCGTACCGGGCGCAGGTCGCGAGCATGCAAAAGGCGGGTCAGATAGACAAGCCGCTGTTCTCGTGCCGCATACACAAGTTCAACCGCTACAACAAGTCCTCCGAGAGATGTCTGCTCGTCACTAGCAACGCGATATATAAATTGGATTCGAACAGTTTCAAGCCACTGAAGAAACCTACTTATATTAAAGACGTGGGGGCCGTGCGCGTGATGAGCTCGGACGTGCAGCTGGTGGTGCTGTGCGTGCCGTCCGCCAAGAACGACCTGGTGGCCGCGCTCGAAGCCCCCGGGGACGACCTGGTCGGCGAGCTGCTGGGCGTGCTGGCCAGCAGATACTGCATGTTGTCTGGCGGCGAGCTGTGCGTGGAGGTGGAGAGCGGCGCCAGCACGCGCTGCACGCTGGGGGGCCGCAGCCGCGCGCTGCAGCTGCCCGCGCACGCCGACCCGCGCGCGCCCGCCTTCACGCACGCGCACAACGTCATCACCTACCACCCGCCGTCCGCGCGCGCCTGA

Protein

MLLLFQGRDTCVLISGESGAGKTEASKFIMKYIAANTTQVHREYIDRVKNVLIQSNTILETFGNAKTNRNDNSSRFGKYMDIHFDYKGDPVGGHISNYLLEKSRVVSLQPGERNFHSFYQLLSSNNPVLKKLGMSTNTAYKILGSERPTAHDSKLYSQTNSAFNALGFSNSVIEDIWNIVAGVILLGEVTFEGGEGGEEGGAVAAGAVAGAVRALGVAEAGLRAVLGRRVLAAGHDLVTKQHSLVDAHYTRLALAKAAYDRLFTWIVQQINKAIDVPAGTYKNTLIGVLDIYGFEIFETNSFEQFCINYCNEKLQQLFIELVLKQEQEEYAREGIQWTPVQYFNNRIICELIDAPHHGVIAIMDEACLNPTQITDQQLLEAMDKRLTGHRHYTSRQLAPTDKKLKHGVDFRITHYAGDVTYAITGFMDKNKDSLWQDLKRLLHSSSNASLAAMWPEGAADIQKTSRRPPSAASLFRSSLAALVAGLHSKEPFYVRCLKPNPLQAPSTWDPLLVQHQTAYLGLVENVRVRRAGFACRVRYDRFVQRYKMLSQYTWPNYRGHSPRDAAAVLLRDLRLDDVHYGHTKLFIRSAKTLQSLEAARAELIPSIVVLLQKLWRGAIARRRYKKMKAALTIFNAWKRYRYRRYISELQTELSRHRGVIRRWPPAPRGLDPALLVAAYRRWRAYLVLRAVPRERWAELRLKVCCGAALRGRRRHWGAARPWRGDYLAAPDYNEKAGAYRAQVASMQKAGQIDKPLFSCRIHKFNRYNKSSERCLLVTSNAIYKLDSNSFKPLKKPTYIKDVGAVRVMSSDVQLVVLCVPSAKNDLVAALEAPGDDLVGELLGVLASRYCMLSGGELCVEVESGASTRCTLGGRSRALQLPAHADPRAPAFTHAHNVITYHPPSARA

Description

Unconventional myosin that functions as actin-based motor protein with ATPase activity (PubMed:30467170). Binds to membranes enriched in phosphatidylinositol 4-5-bisphosphate, and can glide along actin filaments when anchored to a lipid bilayer (PubMed:30467170). Generates left-right asymmetry at the level of single cells, organs and the whole body via its interaction with the actin cytoskeleton, both in the embryo and the adult (PubMed:16598258, PubMed:16598259, PubMed:18521948, PubMed:26073018, PubMed:25659376, PubMed:30467170). Normal left-right asymmetry of the larval midgut and hindgut requires expression in the embryonic hindgut epithelium during a critical time period, 10 to 12.75 hours after egg laying (PubMed:18521948). This period corresponds to a late stage of germband retraction, and precedes left-right asymmetric morphogenesis (PubMed:18521948). Expression in segment H1 of the imaginal ring is required at 0 to 24 hours after pupation for changes of cell shape and orientation in the H2 segment, which then gives rise to normal, dextral looping of the adult hindgut (PubMed:16598258, PubMed:26073018). Required during a critical period, 126-132 hours after egg laying, for normal, dextral rotation of the adult male genitalia (PubMed:16598258, PubMed:16598259, PubMed:22491943, PubMed:26073018, PubMed:25659376). Has a double role by promoting dextral rotation in the posterior compartment of segment A8 of the male genital disk, and in repressing sinistral looping in the anterior compartment (PubMed:16598259).

Subunit

Binds to F-actin (PubMed:7589814). Interacts with arm (PubMed:16598259, PubMed:22491943). Interacts with shg (PubMed:22491943). Interacts with ds (via intracellular region) (PubMed:26073018).

Miscellaneous

Overexpression throughout the embryo reverses the normal left-right asymmetry of the embryonic gut, giving rise to a gut that is a mirror-image of the wild-type (PubMed:16598258). Ectopic expression in the larval epidermis causes dextral twisting of the entire larval body. Ectopic expression in tracheal precursor cells causes dextral spiraling of tracheal branches, giving rise to a spiraling ribbon shape instead of the normal smooth tube. Ectopic expression in epithelial cells causes increased elongation and a clear shift of the membrane orientation toward one side, so that the membrane is no longer perpendicular to the anterior-posterior axis (PubMed:30467170).

Similarity

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Myosin family.

Keywords

Actin-binding   ATP-binding   Calmodulin-binding   Cell junction   Cell membrane   Cell projection   Complete proteome   Cytoplasm   Cytoskeleton   Developmental protein   Lipid-binding   Membrane   Motor protein   Myosin   Nucleotide-binding   Reference proteome   Repeat  

Feature

chain  Unconventional myosin ID

Uniprot

A0A3S2NAI9   A0A2W1BFQ0   A0A2H1VGM8   A0A2P8Y3B6   A0A2J7PHM3   A0A212FGN4   + More
A0A067QRJ8   A0A1Y1LB74   E0VG03   A0A348G643   A0A146M4P3   A0A1B6DEF2   A0A0A9YGP8   E9IBH9   A0A069DWZ1   D6WVP8   A0A151I573   A0A0C9QM31   A0A158NI22   A0A023F3X7   T1PIF4   A0A195EFU6   A0A224XIN5   U5EJT2   E2APC4   A0A195CLC6   A0A151WJT1   A0A3L8D8Q5   A0A2A3E5N1   A0A195F791   A0A232FGS1   A0A0A1WYK4   K7IQ81   A0A088A019   A0A0L0BSF7   A0A3B0K6Y6   A0A1I8PHP1   A0A034WM34   A0A0M9A9S4   E2C8J5   B4LTG9   B4JDW9   B5DIK4   B4G9R7   A0A0K8VTB2   B4KG68   A0A0K8WA16   Q16LJ3   A0A182ILA2   B3MJJ7   Q23978   A0A0C9PT95   B3N5E4   A0A0P6G8S4   A0A182K1R8   B4N2R4   A0A0P5CZH5   B4P0Q4   A0A0P5CZ12   A0A0L7R7D4   A0A182KJL8   A0A0P5A8U7   B0WED3   A0A1S4H370   A0A182HQU7   N6TQE2   A0A182XLG1   A0A0M4EQZ2   A0A182U3T9   A0A182FMY8   A0A1J1I120   B4Q9C1   W8C5Z0   A0A1B0A0M6   A0A182V1H0   A0A0P5TLN7   A0A182MQJ1   A0A0P5ZJ96   A0A1B0G658   A0A1A9Y4Q5   W5JAZ0   A0A182PCH4   A0A182WA60   A0A182YIL6   A0A182QJU2   A0A0P6HC55   A0A2M4A447   A0A2M4A4C6   A0A1W4UFK5   A0A182R7R0   A0A0P5MRR9   A0A131XZ66   A0A147BHG0   A0A1E1XPT8   A0A131Z2L1   A0A224Z3N2   A0A0N8BRF6   A0A1A9UX91   A0A131XP45  

Pubmed

28756777    29403074    22118469    24845553    28004739    20566863    + More
26823975    25401762    21282665    26334808    18362917    19820115    21347285    25474469    25315136    20798317    30249741    28648823    25830018    20075255    26108605    25348373    17994087    15632085    17510324    8201616    10731132    12537572    12537569    7589814    16598258    16598259    18521948    22491943    26073018    25659376    30467170    18057021    17550304    20966253    12364791    23537049    22936249    24495485    20920257    23761445    25244985    29652888    29209593    26830274    28797301    28049606   

EMBL

RSAL01000147    RVE45880.1    KZ150080    PZC73892.1    ODYU01002476    SOQ40010.1    + More
PYGN01000977    PSN38767.1    NEVH01025135    PNF15832.1    AGBW02008642    OWR52887.1    KK853042    KDR12139.1    GEZM01060826    JAV70873.1    DS235129    EEB12309.1    FX985583    BBF97916.1    GDHC01016891    GDHC01004627    JAQ01738.1    JAQ14002.1    GEDC01018061    GEDC01013323    GEDC01009007    GEDC01000987    JAS19237.1    JAS23975.1    JAS28291.1    JAS36311.1    GBHO01036065    GBHO01012793    GBHO01012762    JAG07539.1    JAG30811.1    JAG30842.1    GL762111    EFZ22181.1    GBGD01000296    JAC88593.1    KQ971358    EFA08265.1    KQ976456    KYM84877.1    GBYB01004594    JAG74361.1    ADTU01016187    ADTU01016188    GBBI01002562    JAC16150.1    KA647910    AFP62539.1    KQ978957    KYN27145.1    GFTR01008433    JAW07993.1    GANO01002110    JAB57761.1    GL441504    EFN64723.1    KQ977622    KYN01267.1    KQ983039    KYQ48060.1    QOIP01000012    RLU16318.1    KZ288379    PBC26592.1    KQ981763    KYN36052.1    NNAY01000281    OXU29527.1    GBXI01010143    JAD04149.1    JRES01001427    KNC22977.1    OUUW01000004    SPP79258.1    GAKP01003527    GAKP01003526    GAKP01003525    JAC55427.1    KQ435719    KOX78853.1    GL453666    EFN75725.1    CH940649    EDW63939.1    CH916368    EDW03489.1    CH379060    EDY70146.1    CH479180    EDW29097.1    GDHF01024750    GDHF01010173    JAI27564.1    JAI42141.1    CH933807    EDW11055.1    GDHF01004281    JAI48033.1    CH477904    EAT35186.1    CH902620    EDV32365.1    U07595    AE014134    AY075567    GBYB01004593    JAG74360.1    CH954177    EDV59023.1    KQS70598.1    GDIQ01036955    JAN57782.1    CH963977    EDW78653.1    GDIP01179415    JAJ43987.1    CM000157    EDW87949.1    KRJ97505.1    GDIP01252461    GDIP01167675    LRGB01000930    JAJ55727.1    KZS14906.1    KQ414643    KOC66671.1    GDIP01214862    JAJ08540.1    DS231907    EDS45493.1    AAAB01008980    APCN01001600    APGK01058605    APGK01058606    KB741291    ENN70521.1    CP012523    ALC39232.1    CVRI01000038    CRK94047.1    CM000361    CM002910    EDX04563.1    KMY89567.1    GAMC01004616    GAMC01004615    GAMC01004614    GAMC01004613    JAC01942.1    GDIP01129930    JAL73784.1    AXCM01000205    GDIP01044289    JAM59426.1    CCAG010007078    ADMH02002025    ETN59929.1    AXCN02001858    GDIQ01021319    JAN73418.1    GGFK01002179    MBW35500.1    GGFK01002177    MBW35498.1    GDIQ01152212    JAK99513.1    GEFM01004248    JAP71548.1    GEGO01005174    JAR90230.1    GFAA01002159    JAU01276.1    GEDV01003369    JAP85188.1    GFPF01010027    MAA21173.1    GDIQ01152211    JAK99514.1    GEFH01000691    JAP67890.1   

Proteomes

UP000283053    UP000245037    UP000235965    UP000007151    UP000027135    UP000009046    + More
UP000007266    UP000078540    UP000005205    UP000095301    UP000078492    UP000000311    UP000078542    UP000075809    UP000279307    UP000242457    UP000078541    UP000215335    UP000002358    UP000005203    UP000037069    UP000268350    UP000095300    UP000053105    UP000008237    UP000008792    UP000001070    UP000001819    UP000008744    UP000009192    UP000008820    UP000075880    UP000007801    UP000000803    UP000008711    UP000075881    UP000007798    UP000002282    UP000076858    UP000053825    UP000075882    UP000002320    UP000075840    UP000019118    UP000076407    UP000092553    UP000075902    UP000069272    UP000183832    UP000000304    UP000092445    UP000075903    UP000075883    UP000092444    UP000092443    UP000000673    UP000075885    UP000075920    UP000076408    UP000075886    UP000192221    UP000075900    UP000078200   

PRIDE

A0A088A019    Q23978   

Pfam

PF06017   Myosin_TH1        + More
PF00063   Myosin_head
PF00612   IQ

Interpro

IPR000048   IQ_motif_EF-hand-BS        + More
IPR027417   P-loop_NTPase       
IPR001609   Myosin_head_motor_dom       
IPR036961   Kinesin_motor_dom_sf       
IPR010926   Myosin_TH1       
IPR036072   MYSc_Myo1       

SUPFAM

SSF52540   SSF52540       

Gene 3D

3.40.850.10    

CDD

cd01378  MYSc_Myo1

ProteinModelPortal

A0A3S2NAI9   A0A2W1BFQ0   A0A2H1VGM8   A0A2P8Y3B6   A0A2J7PHM3   A0A212FGN4   + More
A0A067QRJ8   A0A1Y1LB74   E0VG03   A0A348G643   A0A146M4P3   A0A1B6DEF2   A0A0A9YGP8   E9IBH9   A0A069DWZ1   D6WVP8   A0A151I573   A0A0C9QM31   A0A158NI22   A0A023F3X7   T1PIF4   A0A195EFU6   A0A224XIN5   U5EJT2   E2APC4   A0A195CLC6   A0A151WJT1   A0A3L8D8Q5   A0A2A3E5N1   A0A195F791   A0A232FGS1   A0A0A1WYK4   K7IQ81   A0A088A019   A0A0L0BSF7   A0A3B0K6Y6   A0A1I8PHP1   A0A034WM34   A0A0M9A9S4   E2C8J5   B4LTG9   B4JDW9   B5DIK4   B4G9R7   A0A0K8VTB2   B4KG68   A0A0K8WA16   Q16LJ3   A0A182ILA2   B3MJJ7   Q23978   A0A0C9PT95   B3N5E4   A0A0P6G8S4   A0A182K1R8   B4N2R4   A0A0P5CZH5   B4P0Q4   A0A0P5CZ12   A0A0L7R7D4   A0A182KJL8   A0A0P5A8U7   B0WED3   A0A1S4H370   A0A182HQU7   N6TQE2   A0A182XLG1   A0A0M4EQZ2   A0A182U3T9   A0A182FMY8   A0A1J1I120   B4Q9C1   W8C5Z0   A0A1B0A0M6   A0A182V1H0   A0A0P5TLN7   A0A182MQJ1   A0A0P5ZJ96   A0A1B0G658   A0A1A9Y4Q5   W5JAZ0   A0A182PCH4   A0A182WA60   A0A182YIL6   A0A182QJU2   A0A0P6HC55   A0A2M4A447   A0A2M4A4C6   A0A1W4UFK5   A0A182R7R0   A0A0P5MRR9   A0A131XZ66   A0A147BHG0   A0A1E1XPT8   A0A131Z2L1   A0A224Z3N2   A0A0N8BRF6   A0A1A9UX91   A0A131XP45  

PDB

5V7X     E-value=2.31603e-134,     Score=1230

KEGG

101738797    K10356 myosin I | (RefSeq) myosin-IA-like

GO

GO:0003779   GO:0003774   GO:0005524   GO:0016459   GO:0016021   GO:0030898   GO:0048803   GO:0007498   GO:0005938   GO:0000146   GO:0071907   GO:0005546   GO:0007368   GO:0005886   GO:0005912   GO:0042995   GO:0005516   GO:0042623   GO:0005515   GO:0042555   GO:0006260   GO:0004672   GO:0048384  

Subcellular location

Cytoplasm   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.
Cell cortex   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.
Cytoskeleton   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.
Cell membrane   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.
Cell junction   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.
Adherens junction   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.
Cell projection   Detected throughout the cytoplasm. Detected primarily in the basolateral cytoplasmic region of immature enterocytes. Detected also in the apical cytoplasmic region in midgut enterocytes and follicle cells (PubMed:7589814). Colocalizes with the actin cytoskeleton (PubMed:7589814, PubMed:16598258, PubMed:16598259, PubMed:25659376). Colocalizes with arm at adherens junctions (PubMed:16598259). Colocalizes with ds at cell junctions (PubMed:26073018).   With evidence from 4 publications.

Length:

907

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.02369

Exp number, first 60 AAs:

0

Total prob of N-in:

0.00020

outside

1  -  907

 

 

Pi

267.599419

Theta

191.415808

Tajima's D

1.129482

CLR

0.126555

CSRT

0.692265386730664

Interpretation

Uncertain