SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04252
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 1.606 Nuclear   Reliability : 2.303
 

Sequence

CDS
ATGGCAAGAATAACTGACGATTTAACTAAGTTTCACTACGTGCTTTCAAACTTGGACAGACAGTACGCGGTTGAAGTGGAAGACGTCATCACCTCACCACCGGCTACAAAAAAATATGAGTACCTTAAAAGCGAACTGATTAAGCGGCTCTCCGTGTCTAAAGAGAAAAAGGTAAAACAGCTTTTACAATCAGAAGAGTTAGCTGACCGTAAGCCTTCACAATTCTTACGACATCTACGACAACTAGCTGGACCTACAATACCAGACGATTTTCTGCGGTCCATATGGACAAGCCGTCTACCAGACAACCTGCAAACTATCATCGCGTCTCAGATGACTTTGTCTCTTATTGAACTGGCAGATCTGGCTGACAGAGTCCATGACATCGCACCTAGTGCACCTCAGGTGGCAACAACATCTTCAAGAGAAGACTCGGCACTGGAAATCATGGCTCGACAAATAACTGAACTAACAAAACAATCGATAATGGCGACTGAAGATTGCCCATTAAACACCGGTCGCCTCTTCGTGACGGATAGAAGATCACGTCTTCAGTTTCTGGTCGACACCGGAAGTGATGTTTGCGTATTTCCTCGCTCTGCGCTTCGTCAACGACGGGAAAAGACGGAATACGAGCTGTGCGCGGCCAATGGTTCTACGATTAACACGTACGGGTACATTGAACTTAATCTCAACCTAGGTTTGCGTAGAAATTTTGTGTGGCGTTTTACAGTAGCTGATGTAACTAAAGCTATCATTGGCGTAGATTTTCTGTCTCATTTTAACCTTATCGTAGACATACGCAATAAGCTTTTAATTGATGCTAGCACCAAATTGTCAACCGTAGCTGCTTCTGCTGTAACTGATAGTTTAATATCTAGTGTAAAGGTCGTAACCGGCAATTCTAAATATCATATTTTGCTTTCTAAGTTTCCAGAGCTGACACGACCGGCAGGCATATACCACACACCAAAACACAACACAGTACATCACATCCGCACCACACCAGGCCCCCCGGTTGCCTGTACTCCTCGAAGACTCGCACCTGAAAAATTGAAGATTGCAAGATCAGAATTCGAAGCAATGTTGGCTAACGGCACCACGCGACCCTCTGAGAGTCCCTGGTCCGCACCACTACACCTCGCTGCTAAAAAGGAGAACGGATGGCGACCATGTGGCGACTACCGTATGCTAAACGCTCGCACGATACCAGATAAGTATCCGATTCGCCATATCCAAGACTTTGCGCATAGCCTATCTGGCTGTCGTGTATTTTCTACCATTGACCTGGTTAAAGCTTTTAATCAAATACCGGTTTTTGAAGACGATATACCAAAAACAGCGATAACAACCCCGTTTGGACTCTTTGAATTTCCGTACATGACGTTTGGGTTGCGAAACGCAAGTCAAACTTTTCAGAGGTTTGTCGATGAGATGACACGTGGCTTAGATTTCTGCTTCCCCTATATCGATGATTTTCTCATATTTTCCAGTAATGAATCTGAGCACCTGGAGCACCTACATCAGCTTTTCATCAGAATGAAAGAATATGGAATGCTCATCAACACTGCAAAATGTGTCTTCGGTGCATCGAAGGTAGAATTTCTTGGCTACCATATTGACGCAAATGGAACAAAACCTCTGGAAAGCAAGGTACAAGCCATCAAAGAATTTCCTGTCCCTAAAACAGCTAAGCAGCTTAGAAGATTCTTGGGCATGATAAACTTCTATCGTAGATTTATCCCCAAAGCTGCAAATATTCAAGCTGCTCTAAGCTCCTTGCTGACAGGTTCTATAAAAGCATCACATCCAATTGAGGTGACAGGGGACTCACTAAAGTCATTTGAAGACTGTAAGGAAAGCCTTTGTAACGCAGCTTTACTTGCTCATCCTGACTGTGATGCCAAGGTGAGCTTAGTGACTGATGCGTCTGATTTTGCTATTGGTGGAGTATTACAACAGCTAAAGGACGGAAATTGGCAACCTCTGGCATTCTTCTCTCGTAAGTTAAGCCCATCGCAACAAAAATATTCACCTTACGATCGAGAGCTTTTGGCAATTTACGAGAGCATTAAATACTTCAGGCATTGGTTAGAAGCAACAACTTTTACCATCTATACTGACCATAAACCATTATGCTTCGCATTCCATCAGCGGAAGGCAAACTGTAGTCCACGTCAGTATAGACATTTAGACTACATATCACAGTTTTCGACTAACATACAACATATATCCGGAAAAGATAATGTTGTGGCTGACACTCTTTCCCGGGCTGGTCAAGTTGAAGAACTGCAAAATCCTGTAAATCTCGAAACGTTAGCCAAAGCGCAAGATACGGACACTGAACTAGTGAACTTCTTAAGACGGCACACTTCGTTACAACTCGTGAAGCTAAATATACCAGGAAGTCAAAAACAATTGTACTGCGATGTCAGCACGCCGACTCCTAGGCCTCTGGTGCCAAAGCACTTACGGAAACAAATATTTGAAAGCTTGCACTCATTAAGCCATCCCGGTACAAAGGCTAGCGCTAAACTAGTAGCTGAACGATTTGTATGGCCTTCACTCAGGAAGGACTGTCGTGACTGGGCTAGAGCGTGTTTAGCTTGCCAACGCTCAAAAATAAATCGACATGTTTGCTCACCGTTAGGCACCTTCGATTTACCAAAAGCAAGATTCAATCATGTACACCTAGACATCATTGGACCGTTACCTCCTTCCGGTGATTACAAGTACTGTTTAACAGCAATTGATCGTTTTACCCGGTGGACTGAAGCTATACCACTGACTGATATTACGGCCGAATCAGTAGCAAAAGCTTTCTTATCGGGATGGATTGCCCGATTTGGTTGTCCCACTGACATCGTCACTGATCGCGGCAGACAATTTGAATCAGCACTATTCGATCAACTTTCCAAATTCATAGGGTTTAAGCATCGCAAAACTACCAGCTACCATCCTCAATGCAATGGTCTCATTGAAAGGTTTCATCGGCAGCTGAAGGCTGCTATTACATGTCATGCCGACATCAACTGGACCGAAACTTTACCAATCGTGCTCCTCGGCATAAGAAGTGCTTATAAGGAGGACATTCAGTGCTCGTCAGCCGAATTACTATATGGTGAACCCCTGCGCCTACCAGGAGAATTTTTTGGTCATAAAACTGACAAGTATGATACGGATATAACTGATTTTTCAGCCCGCATCAGGCTATTTGCCAGCAATTTACAGCCAGTCTCAACATCACATCATTCTACCCAGAAGATATTTATCTACAAAGATCTTGCATCTTGCTCGCACGTGTTCCTCAGAGAAGACGCAGTCAAACGTGGATTTCAACCAGCGTATAAAGGCCCCTACAAAGTTATTAACAGAGACAACAAAGTATACAAGCTGTTAATAAACGGAAAAGAGATCAACGTTTCCATAGACAGGATCAAACCAGCTTACTTATTAGATAGCAACACAGAAAAAATACCCAAGCAACTCTATGATGAAAAAGAAAGTCTGGAATCGCCGCGCTCGTCTCACAGAACAAGATCGGGTAGAAAAGTCACATTTCCAGACTACTATCGCCCATCCTGA
Protein
MARITDDLTKFHYVLSNLDRQYAVEVEDVITSPPATKKYEYLKSELIKRLSVSKEKKVKQLLQSEELADRKPSQFLRHLRQLAGPTIPDDFLRSIWTSRLPDNLQTIIASQMTLSLIELADLADRVHDIAPSAPQVATTSSREDSALEIMARQITELTKQSIMATEDCPLNTGRLFVTDRRSRLQFLVDTGSDVCVFPRSALRQRREKTEYELCAANGSTINTYGYIELNLNLGLRRNFVWRFTVADVTKAIIGVDFLSHFNLIVDIRNKLLIDASTKLSTVAASAVTDSLISSVKVVTGNSKYHILLSKFPELTRPAGIYHTPKHNTVHHIRTTPGPPVACTPRRLAPEKLKIARSEFEAMLANGTTRPSESPWSAPLHLAAKKENGWRPCGDYRMLNARTIPDKYPIRHIQDFAHSLSGCRVFSTIDLVKAFNQIPVFEDDIPKTAITTPFGLFEFPYMTFGLRNASQTFQRFVDEMTRGLDFCFPYIDDFLIFSSNESEHLEHLHQLFIRMKEYGMLINTAKCVFGASKVEFLGYHIDANGTKPLESKVQAIKEFPVPKTAKQLRRFLGMINFYRRFIPKAANIQAALSSLLTGSIKASHPIEVTGDSLKSFEDCKESLCNAALLAHPDCDAKVSLVTDASDFAIGGVLQQLKDGNWQPLAFFSRKLSPSQQKYSPYDRELLAIYESIKYFRHWLEATTFTIYTDHKPLCFAFHQRKANCSPRQYRHLDYISQFSTNIQHISGKDNVVADTLSRAGQVEELQNPVNLETLAKAQDTDTELVNFLRRHTSLQLVKLNIPGSQKQLYCDVSTPTPRPLVPKHLRKQIFESLHSLSHPGTKASAKLVAERFVWPSLRKDCRDWARACLACQRSKINRHVCSPLGTFDLPKARFNHVHLDIIGPLPPSGDYKYCLTAIDRFTRWTEAIPLTDITAESVAKAFLSGWIARFGCPTDIVTDRGRQFESALFDQLSKFIGFKHRKTTSYHPQCNGLIERFHRQLKAAITCHADINWTETLPIVLLGIRSAYKEDIQCSSAELLYGEPLRLPGEFFGHKTDKYDTDITDFSARIRLFASNLQPVSTSHHSTQKIFIYKDLASCSHVFLREDAVKRGFQPAYKGPYKVINRDNKVYKLLINGKEINVSIDRIKPAYLLDSNTEKIPKQLYDEKESLESPRSSHRTRSGRKVTFPDYYRPS

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01012479    KMQ86204.1    LBMM01013040    KMQ85849.1    LBMM01009142    KMQ88359.1    + More
LBMM01013103    KMQ85815.1    KQ971355    EFA07205.2    GBXI01015889    JAC98402.1    AAGJ04130731    LBMM01001181    KMQ96765.1    LBMM01012134    KMQ86388.1    ABLF02030693    ABLF02030697    GEGO01003687    JAR91717.1    GBXI01017046    JAC97245.1    KL363241    KFD51254.1    GBXI01003773    JAD10519.1    AAGJ04001742    LBMM01012567    KMQ86146.1    LBMM01012160    KMQ86374.1    EF426679    ABP48077.1    KL367544    KFD65142.1    KL367778    KFD59660.1    KL367543    KFD65158.1    GFDL01003994    JAV31051.1    LN877232    CTR11708.1    AAGJ04112098    KQ973093    EFA13472.2    LBMM01012451    KMQ86215.1    GEGO01003506    JAR91898.1    GEGO01001281    JAR94123.1    GEGO01004649    JAR90755.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GGLE01001814    MBY05940.1    GFPF01012375    MAA23521.1    GEGO01004484    JAR90920.1    BK004070    DAA04500.1    GEGO01000286    JAR95118.1    GGFK01003401    MBW36722.1    GEGO01004475    JAR90929.1    DF142933    GAA49140.1    JYDT01000067    KRY86703.1    GGFK01003442    MBW36763.1    JYDR01000002    KRY79251.1    CABG01000050    CAZ37786.2    KL367655    KFD60653.1    MRZV01001828    PIK35719.1    GEGO01004686    JAR90718.1    KL367479    KFD72009.1    GDHF01021808    JAI30506.1    GDHF01001116    JAI51198.1    GEDV01001796    JAP86761.1    GGLE01003443    MBY07569.1    GDHF01014424    JAI37890.1    BK004066    DAA04495.1    BN000802    CAJ00250.1    LBMM01012030    KMQ86466.1    GDKW01003376    JAI53219.1    GACK01008900    JAA56134.1    AY013565    AAK07486.1    KL367664    KFD60497.1    AY013563    AAK07485.1    AY013569    AAK07487.1    KL367552    KFD64647.1    AAZX01013940    ABLF02040931    ABLF02040938    AAGJ04000250    JYDJ01000353    KRX36608.1    KL367492    KFD69854.1    GBYB01009311    JAG79078.1    JWZT01003175    KII67485.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    AAZX01006801    AAZX01023483    ABLF02058233    JWZT01004124    KII64665.1    JWZT01002058    KII70465.1    ABLF02005645    ABLF02042063    JYDI01000020    KRY58560.1    LBMM01012633    KMQ86092.1    KRY58561.1    AAZX01023279    AAGJ04172791    JYDV01000002    KRZ45603.1    AAZX01009606    JYDH01000101    KRY32299.1    KL367564    KFD63933.1    FN356213    CAX83702.1    FN356212    CAX83701.1    JWZT01001363    KII72172.1    JYDO01000387    KRZ65366.1    KL363373    KFD46409.1    NIVC01003188    PAA52757.1    IAAA01040175    LAA10459.1    IAAA01033850    LAA08869.1    AAZX01004786    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF02709   Glyco_transf_7C
PF13733   Glyco_transf_7N
PF00013   KH_1
PF13359   DDE_Tnp_4
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR041373   RT_RNaseH       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR013032   EGF-like_CS       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027791   Galactosyl_T_C       
IPR036612   KH_dom_type_1_sf       
IPR003859   Galactosyl_T       
IPR004087   KH_dom       
IPR004088   KH_dom_type_1       
IPR027995   Galactosyl_T_N       
IPR029044   Nucleotide-diphossugar_trans       
IPR027806   HARBI1_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF54791   SSF54791       
SSF53448   SSF53448       
PDB
4OL8     E-value=7.40539e-71,     Score=684

Ontologies

Topology

Length:
1194
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10493
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00474
outside
1  -  1194
 
 

Population Genetic Test Statistics

Pi
123.738164
Theta
28.266051
Tajima's D
0.35825
CLR
0.337922
CSRT
0.480425978701065
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号