SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04246
Pre Gene Modal
BGIBMGA008115
Annotation
polyprotein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.17
 

Sequence

CDS
ATGGAAGGTATCACAGGAAAGCTTCAGATTGGCCTCCTAGATGAAAAAAATTGGGACACCTGGAAATACAAAGCCTTATGCTTACTACGCACCGTACCGTCGGCCCTAGAAGTAGTTGAAGGATCGTTCCAGGAGCCCACTCGTCCACCTACCGGATGCGGCGATGCTGAATTGGCGGCTTATCAACAACAAAAAGATAAGTTTGATAAAGCTGATGCCAGCGCTATCCTAATACTTACCACCAATATGCAAGAAGACACACTTCGAAAAGTGATGCGGTTCACTAAAGTACGTGATGTCTGGTTAGAGCTCCACAGGCTGTTCGACGGAACAAATGAGGACAAAACCTACAACCTGTGTATGAGTTTCTTCAGCTTTAAAAGGGATCAAGCAGACGACATAGCCACTCACATGTCAAAATTAAAGAACATTTGGACTGAACTGAATCAAGAACTCAAGAAGGACAGTAACCAAGAGCTACCCGAACTGCTACTTGTTTGTAAGATACTGGACACGCTTGATGATTCATACTTCAGCTTCAGAAGTAGTTGGCTCCTACTGCCCAAATCCAACCGTACTGTAGAAAACCTAACTAGTCATCTCTGCGCATTTGAAAGGGCACTGCAAGGTAACAACGTACCTTCGCATCATTCGGAAGCCCTGGTTTCGAATACGGAAAAGAAGAAGGACAAGAAGCTTAAATGCAACTACTGCCTAGGTATTGGCCACAGAGTACGCAACTGTCAAAAATGGATCCGTGACGGTAGACCTCCTAAGAGCCAAAATCCGACCCAGACAGCAACGCCTTCTACTTCAAAGACCGCTAATTTGTTACTCATGTCTTTAGAAGACAACGAAATCTTCACAGTTTCACGGGACAACGAGAACTGGTACATAGATAATGGTGCAACAAGCCACGTCACCAACAGAGCTGATTTTTTCCAAACCTACGAACATTTCAATGAGAACTACACTGTTACAACGTCCGCTGGTAATGAAGTCCGTGCCAAAGGCAAAGGAACAGTACAGCTCAGAGGATATGTTAACGGGAAACAAATCGACATCAGCCTGCAAGACGTCTGGTACGTTCCGGCCATAAGCAAGAACCTCTTCTCCGTACTCGCACTTCACGACCGAGTCCCGAATAGCACTTTTTCATCCAGGACAACTGAATGCAACGTCATTGTCAACGGGAAAGTATGCTTAATAGGGAAGAGACAAAAACAAGGTGGCTTATATCGACTGGAAGTAAAACCCGTACTGCCAGAAAAACCACCCGAAGTCTTTGCAACTACAGCAACGATGCAACTGTACCACGAGAGACTCGCTCACCAAAATAAAAGACACGTAAGAGCGACGATCCAACGCGAACTAGGTCTAAACCTGCCGATAGATAAAGAGACCTGTGAAGGCTGCATCTTTGGAAAGGCGCATCGACTTAAATTCGGTACAAGAACCCGAGCTACCGCGCCCGGAGAAATTGTACACACCGACGTTTGCGGACCGTTTCAATCTAGCTTCTCAAGCTATAAGTACTACGTTCTGTTCAAAGTCGACTTTACTGGCTATCGTATGGTGTACTTCATACGCAAGAAGTCCGAGGTCAAAGACAAGTTAGTTTTGATGATCGCTCAAACTAAAACAGTCGGACACACCATAAAATGCCTTCTAAGTGACAACGGCGGTGAATTTGACAACGCGTCCATAAAAAATGTTTTAGACACACACGGAATAGCACAGCGACTAGTCACCCCGTATACACCTGAACAAAACGGAGTAAGCGAAAGGGAGAACAGAACCCTAGTTGAGACAGCAAGATCAATGATGTACGCTCATGAGCCATTACCGCAAGTGCTATGGGCAGAGCTCATTAATACCGCCGCATACATACTAAACAGAACAGGTCCCACAAGTTTAGATAAATCTTCGCATGAACTTTGGTATGGAAAGAAACCTATTATTAAACATCTCCGTATAATAGGCTCAATCGCATACGTCCATATTCCAAAGCAGAAGCGTAGAAAATTCGACAAAAAGGCGATAAAAGGTCGACTTATCGGGTACGACGAAGATTGCTACCGTATCTGGGTCACAGACGGAAAACACTCGACGCTCGTCCGTTCTCGTGACGTAATCTTCGATGAGAAACCTCTTCCCATCTGTAATAGTGAAATTCCTAAAACAGAAGTTGAGACAAGAGAATATCCGATTACCATAACGCCAAATACGAACTTAGAAATAGAAGTTGCAATTCCAGAGCAAACACACGTTCACGAGGGAGATACAACTACTGAAACAAACTCCAACGACCATGATCATGTTCTCGAGGGAGAAGAATCGGATCAAGTCCTCTACGAAGACCATGACCAGGAAGACGAAACGACAGTTCCAGAAGAATTATTTTATGATGCTGAACCACCGCCAACCGGCTATAATCTTAGAGATCGCTCACTGATTCGACGTCCTGAGAGACTAAGAGATTACGTCTGTATCACTGAAACATTCCCAAATAATTTTGCAGACGCTATGAAAAGGGACGATCGCGAAGAATGGCAAAGGGCAATGGATAGCGAATTGAAATCCTTCGAAGACCTGAACGTTTGGACGCCGTGTGCATTGGCAAAAGGACGAAAAGCACTTCCCTGCAAATGGGTTTTACGGATCAAACGAAATCCAGATGGCACGATCGACAAATACAAGGCTCGACTTGTCGTAAAAGGGTACAGACAAAGGAAAGGAGTAGACTATGACCAGACCTTCAGTCCTGTCGCACGCCTGACTACTGTACGAGCACTACTCAGTGTTAGCGCGCATGAAAACTTACATCTGGTCCAATTCGACGTTTGCACAGCCTTTCTGAACGGAAAGCTCGAGGAAGAAATATACGTTCAACTGCCAGAAGGGTGCAACCTCACGGAAGGAACGTCTACCGTTTTCAAGCTTAACCGTAGCCTGTACGGACTTAAACAAGCACCAAGGTGCTGGAATTCTTGCTTTCAAGAGATCCTATTGGATATGAACTTCAAACAGTCCGAAGCTGATTGCTGCTTATATTCAAGAGAAGTTAACGGGAAGAAACTACTGATCACGTTGTACGTCGATGACGCTATTCGCTATTCTGGAGGCACAGTTTCATGGATCAGTCAGCGACAAACATCGGTCGCTATCTCCACTACAGAAGCCGAAATTGTGGCAGCTAGTGAAGCTGGCAGAGAACTAATGTGGCTTGCTAGACTATACCAGGCATTGACTACAATTGCGGACGTACCGGTTCTGCATGTGGACAATGAAGCTGCTGTTCGTCTTGCTCACAACCCCGAGTTTCACAAGAGAACGAAGCATATCCGGCTCAGACATTTCTACGTCAGAGAATTGGTAACTGAGGGTATCTGCAACGTTGTACGGATCGGAACAAAGGATCAAGTCGCAGACATCCTTACCAAACCACTACCTCGTACGTCATATGCAGTTCTACGCCAGGCGCTAGGACTGTGTACTATGTAA
Protein
MEGITGKLQIGLLDEKNWDTWKYKALCLLRTVPSALEVVEGSFQEPTRPPTGCGDAELAAYQQQKDKFDKADASAILILTTNMQEDTLRKVMRFTKVRDVWLELHRLFDGTNEDKTYNLCMSFFSFKRDQADDIATHMSKLKNIWTELNQELKKDSNQELPELLLVCKILDTLDDSYFSFRSSWLLLPKSNRTVENLTSHLCAFERALQGNNVPSHHSEALVSNTEKKKDKKLKCNYCLGIGHRVRNCQKWIRDGRPPKSQNPTQTATPSTSKTANLLLMSLEDNEIFTVSRDNENWYIDNGATSHVTNRADFFQTYEHFNENYTVTTSAGNEVRAKGKGTVQLRGYVNGKQIDISLQDVWYVPAISKNLFSVLALHDRVPNSTFSSRTTECNVIVNGKVCLIGKRQKQGGLYRLEVKPVLPEKPPEVFATTATMQLYHERLAHQNKRHVRATIQRELGLNLPIDKETCEGCIFGKAHRLKFGTRTRATAPGEIVHTDVCGPFQSSFSSYKYYVLFKVDFTGYRMVYFIRKKSEVKDKLVLMIAQTKTVGHTIKCLLSDNGGEFDNASIKNVLDTHGIAQRLVTPYTPEQNGVSERENRTLVETARSMMYAHEPLPQVLWAELINTAAYILNRTGPTSLDKSSHELWYGKKPIIKHLRIIGSIAYVHIPKQKRRKFDKKAIKGRLIGYDEDCYRIWVTDGKHSTLVRSRDVIFDEKPLPICNSEIPKTEVETREYPITITPNTNLEIEVAIPEQTHVHEGDTTTETNSNDHDHVLEGEESDQVLYEDHDQEDETTVPEELFYDAEPPPTGYNLRDRSLIRRPERLRDYVCITETFPNNFADAMKRDDREEWQRAMDSELKSFEDLNVWTPCALAKGRKALPCKWVLRIKRNPDGTIDKYKARLVVKGYRQRKGVDYDQTFSPVARLTTVRALLSVSAHENLHLVQFDVCTAFLNGKLEEEIYVQLPEGCNLTEGTSTVFKLNRSLYGLKQAPRCWNSCFQEILLDMNFKQSEADCCLYSREVNGKKLLITLYVDDAIRYSGGTVSWISQRQTSVAISTTEAEIVAASEAGRELMWLARLYQALTTIADVPVLHVDNEAAVRLAHNPEFHKRTKHIRLRHFYVRELVTEGICNVVRIGTKDQVADILTKPLPRTSYAVLRQALGLCTM

Summary

EMBL
AB378753    BAG68376.1    GEZM01078128    GEZM01078127    JAV63002.1    JYDH01000102    + More
KRY32233.1    KRY32232.1    JYDO01000312    KRZ65659.1    JYDJ01000235    KRX39371.1    KRX39370.1    JYDM01000206    KRZ83588.1    JYDR01000237    KRY65040.1    JYDV01000213    KRZ24707.1    KL367684    KFD60227.1    KL367545    KFD65036.1    JYDT01000007    KRY92484.1    ABLF02020242    ABLF02020246    ABLF02042026    KL367520    KFD66858.1    GEZM01007166    GEZM01007165    JAV95327.1    GEZM01063217    JAV69187.1    GEZM01078105    JAV63008.1    LBMM01012672    KMQ86059.1    AAZX01004352    NEVH01009420    PNF33053.1    GEZM01063091    JAV69316.1    GDIP01034138    JAM69577.1    AAZX01010628    AAZX01013403    GEZM01096605    JAV54776.1    GEHC01000927    JAV46718.1    GDIP01019956    JAM83759.1    GDIP01039936    JAM63779.1    GEZM01096656    JAV54693.1    GDIP01162319    JAJ61083.1    GDIP01239569    JAI83832.1    JXUM01155348    KQ572178    KXJ68066.1    JXUM01085595    KQ563513    KXJ73717.1    LBMM01010801    KMQ87218.1    GDUN01000214    JAN95705.1    GDIP01209409    JAJ13993.1    LBMM01007046    KMQ90088.1    GBHO01016859    JAG26745.1    GBHO01043059    JAG00545.1    GDIP01198316    JAJ25086.1    AAZX01023229    GGFM01000952    MBW21703.1    GBHO01012744    JAG30860.1    GGFL01004951    MBW69129.1    GGFM01000953    MBW21704.1    GDUN01000696    JAN95223.1    AAZX01002176    AAZX01002186    AAZX01006620    AAZX01018918    AAZX01023250    AAZX01023349    JXUM01136904    KQ568499    KXJ68982.1    JXUM01099923    KQ564528    KXJ72133.1    LBMM01008998    KMQ88473.1    GDIQ01169648    GDIQ01030305    JAN64432.1    GEHC01000928    JAV46717.1    GDIQ01031455    JAN63282.1    FJ238509    ACI62137.1    GDUN01000697    JAN95222.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    GGMR01012789    MBY25408.1    NCKU01012701    RWS00004.1    LBMM01012772    KMQ86003.1    LBMM01010133    KMQ87653.1    GGFL01005562    MBW69740.1    GDUN01000694    JAN95225.1    FJ544853    ACL97384.1    OIVN01000313    SPC78143.1    CM007900    OTG06758.1    NWSH01000816    PCG74073.1    OIVN01006239    SPD28653.1    FJ544854    ACL97385.1    LBMM01012492    KMQ86193.1    LBMM01012449    KMQ86217.1   
Pfam
PF13976   gag_pre-integrs        + More
PF07727   RVT_2
PF00665   rve
PF00098   zf-CCHC
PF13696   zf-CCHC_2
PF13961   DUF4219
PF14244   Retrotran_gag_3
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR012337   RNaseH-like_sf       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR025829   Zn_knuckle_CX2CX3GHX4C       
IPR025314   DUF4219       
IPR029472   Copia-like_N       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
3S3N     E-value=0.00261656,     Score=101

Ontologies

Topology

Length:
1167
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00254
Exp number, first 60 AAs:
0.00033
Total prob of N-in:
0.00003
outside
1  -  1167
 
 

Population Genetic Test Statistics

Pi
213.620554
Theta
14.029273
Tajima's D
0.890794
CLR
0.885463
CSRT
0.636518174091295
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号