SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04243
Pre Gene Modal
BGIBMGA014261
Annotation
PREDICTED:_metabotropic_glutamate_receptor_2-like_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 4.798
 

Sequence

CDS
ATGCGGCCGGCGAGTGGCGCTGATTTACTGCGCTACCTAAGGAAAGTCAACTTTACTGGTGTGAGCGGTGACGAGTTCCACTTCGACAGCAATGGCGACGGTCCAGCCAGGTATAACATCCTGCACTTCAAGCAAGTCTCACGAGGAACATACAGCTGGGTTAACGTTGGCCAGTACTTGGATGGAGAACTTCAACTACATATCAAGGACATTCAGTTCAAGTGGGGAGAAAGACATCCACCGGAGTCAGTGTGCAGCGCGGAGTGCGAACTCGGACAAGCCAAGCAGTACGTGGAGGGCGAGAGTTGCTGCTGGCACTGCTTCAACTGCACTCAGTACGAGATCCGGTCTCCGTACGTGGAGACAGCATGTATGGTGTGTCCGCGCGGTACGTTACCGGATCTAACCAGGACGCAATGTCGACCGATCCCTGAAGCGTACTTAAGACCTGACTCCGCGTGGGCGATCGGCGCTATGTCGTTCTCATCTGTCGGAATATTACTGACTGCATTTGTCTGCGGAGTGTGGGTTAGACACAGTTCGACTCCAGTAGTGCGTGCGAGCGGGAGGGAGCTATCCTACGTCCTGCTCGCCGGTATCCTCATGTGCTATCTCGTTACATTCGCCCTGGTGTTCAGGCCCACGGACATACTTTGCTCTATTCAAAGATTCGGCACCGGTTTCTGCTTTACGGTCATCTACGCCGCTCTTCTCACCAAGACAAACAGGATCTCCAGGATATTCAATGCCAGTAAACATTCAGCAAAAAGACCTATCCTCATATCTCCAACTTCCCAACTAGCTATATGCGCTGGACTTGTGTCCATTCAGGTACTTATAGTGGTAGTCTGGATGATAGTGGCCCCAGCCAGAGCGATGTTCCACTACCCGACCAGAGAAGACAACATGCTAGTTTGCGACTCCTACGTAGATGCTTCATACATGATAGCGTTTTTCTATCCCATCGTACTAATTCTCATCTGTACTGTCTACGCCGTTCTCACCAGGAAGATACCGGAGGCTTTCAACGAGAGCAAGCACATTGGTTTTACAATGTACACCACCTGCGTCATCTGGTTGGCATTTGTGCCGTTGTACTTCGGTACCGCGAGCCACGTGCCTTTGAGGGTCACCAGCATGGCGGTCACCATCTCCCTGAGCGCCAGCGTCACGCTCATCTGCTTGTTCTCGCCAAAGCTGTATATAATACTCATCCGTCCGGAGAGGAACGTGCGTCAAAGCATCATGCCGGTGAGGTATAGCCGGAAGCCGCCTCCGCCGCATCCGCTAAACATCCAAGTCAAAAAACCACCGTGCGCCGACAAAGAGACGCAAACGGATCCGGCCGTGTTCAAGTTGTCCAACGGACAAGTCGTCAACGACACGACACGGAAAGAAGAGAAGATAAACAAAGATGAAAAAGCAAAAGAAACAAAACAATGTAACAACGTAAATAATGTTAGCGATTCGAAGAACACGCAGACTGAAAAGACCGCCTCCTTATAG
Protein
MRPASGADLLRYLRKVNFTGVSGDEFHFDSNGDGPARYNILHFKQVSRGTYSWVNVGQYLDGELQLHIKDIQFKWGERHPPESVCSAECELGQAKQYVEGESCCWHCFNCTQYEIRSPYVETACMVCPRGTLPDLTRTQCRPIPEAYLRPDSAWAIGAMSFSSVGILLTAFVCGVWVRHSSTPVVRASGRELSYVLLAGILMCYLVTFALVFRPTDILCSIQRFGTGFCFTVIYAALLTKTNRISRIFNASKHSAKRPILISPTSQLAICAGLVSIQVLIVVVWMIVAPARAMFHYPTREDNMLVCDSYVDASYMIAFFYPIVLILICTVYAVLTRKIPEAFNESKHIGFTMYTTCVIWLAFVPLYFGTASHVPLRVTSMAVTISLSASVTLICLFSPKLYIILIRPERNVRQSIMPVRYSRKPPPPHPLNIQVKKPPCADKETQTDPAVFKLSNGQVVNDTTRKEEKINKDEKAKETKQCNNVNNVSDSKNTQTEKTASL

Summary

Similarity
Belongs to the G-protein coupled receptor 3 family.
EMBL
KZ150080    PZC73882.1    ODYU01001945    SOQ38848.1    KQ460211    KPJ16524.1    + More
KQ459302    KPJ01848.1    NWSH01002590    PCG67907.1    KZ150487    PZC70703.1    NWSH01001473    PCG71140.1    CH902619    KPU75778.1    KQ435855    KOX70662.1    KQ435036    KZC14082.1    KQ414661    KOC65555.1    EDV35656.2    CM002911    KMY92273.1    KMY92274.1    KMY92275.1    GDHF01030797    JAI21517.1    CM000157    KRJ98364.1    CH954177    KQS70875.1    KZ288317    PBC28294.1    AB161182    BAD08344.1    AE013599    AGB93339.1    CM000071    KRT01640.1    CH940648    EDW60858.2    KMY92276.1    OUUW01000001    SPP73687.1    GDHF01016218    JAI36096.1    AAF59081.3    ACL83073.1    EDW89357.2    CH480816    EDW46948.1    JRES01000171    KNC33679.1    AJ581534    CAE46392.1    AAF59082.3    EDV59512.1    GAMC01002043    JAC04513.1    CH479181    EDW31631.1    CH916367    EDW00818.1    EDY68791.2    BT033068    AAS64894.1    ACE82591.1    CH963849    EDW74207.1    CH933808    EDW10117.2    GEZM01047799    JAV76746.1    CP012524    ALC40933.1    NNAY01002683    OXU20784.1    KQ976749    KYN08785.1    KQ982691    KYQ52223.1    NEVH01000606    PNF43434.1    AGBW02008952    OWR52095.1    AJWK01002248    DS235129    EEB12315.1    KQ980765    KYN13374.1    PNF43433.1    KQ976641    KYM78799.1    CVRI01000074    CRL08038.1    KK852776    KDR16788.1    CCAG010014001    CCAG010014002    GL888063    EGI68439.1    KQ981272    KYN43846.1    GL451914    EFN78267.1    APCN01002995    ADTU01006103    AAAB01008900    EAA09380.4    AGBW02014793    OWR41061.1    ATLV01024163    KE525350    KFB50889.1    GEHC01000817    JAV46828.1    UFQS01000437    UFQT01000437    SSX03930.1    SSX24295.1    ACPB03017251    ACPB03017252    ACPB03017253    ACPB03017254    GBHO01007850    GDHC01013000    JAG35754.1    JAQ05629.1    GBHO01035356    GBHO01035354    GBHO01030107    GBHO01024922    GBHO01024919    GBHO01024918    GDHC01019174    JAG08248.1    JAG08250.1    JAG13497.1    JAG18682.1    JAG18685.1    JAG18686.1    JAP99454.1    GBHO01007849    GDHC01001086    JAG35755.1    JAQ17543.1    ABLF02023192    GL442888    EFN62787.1    GGMR01016299    MBY28918.1    KK107623    EZA48425.1    GFXV01003936    MBW15741.1    ACPB03010517    JTDY01001683    KOB73168.1    KQ971367    KYB25635.1    KYB25638.1    CH477615    EAT38269.2    ACPB03010165    ACPB03010166    CH982034    EDX15484.1    GDIQ01176096    JAK75629.1    GDIQ01111270    JAL40456.1    GDIQ01155161    JAK96564.1    GDIQ01136570    JAL15156.1    GDIQ01139071    JAL12655.1    GDIQ01057440    JAN37297.1    GDIQ01159362    JAK92363.1    GDIQ01142811    GDIQ01142809    JAL08915.1   
Pfam
PF07562   NCD3G        + More
PF00003   7tm_3
PF01094   ANF_receptor
PF00176   SNF2_N
PF00271   Helicase_C
PF13892   DBINO
PF04083   Abhydro_lipase
Interpro
IPR000162   GPCR_3_mtglu_rcpt        + More
IPR001828   ANF_lig-bd_rcpt       
IPR017978   GPCR_3_C       
IPR038550   GPCR_3_9-Cys_sf       
IPR017979   GPCR_3_CS       
IPR028082   Peripla_BP_I       
IPR011500   GPCR_3_9-Cys_dom       
IPR000337   GPCR_3       
IPR029030   Caspase-like_dom_sf       
IPR000330   SNF2_N       
IPR027417   P-loop_NTPase       
IPR038718   SNF2-like_sf       
IPR014001   Helicase_ATP-bd       
IPR020838   DBINO       
IPR001650   Helicase_C       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR029058   AB_hydrolase       
IPR006693   AB_hydrolase_lipase       
SUPFAM
SSF53822   SSF53822        + More
SSF52129   SSF52129       
SSF52540   SSF52540       
SSF57184   SSF57184       
SSF53474   SSF53474       
PDB
6N52     E-value=3.63127e-93,     Score=872

Ontologies

Topology

Subcellular location
Cell membrane  
Length:
501
Number of predicted TMHs:
7
Exp number of AAs in TMHs:
153.86702
Exp number, first 60 AAs:
0.00042
Total prob of N-in:
0.00264
outside
1  -  152
TMhelix
153  -  175
inside
176  -  191
TMhelix
192  -  211
outside
212  -  220
TMhelix
221  -  238
inside
239  -  265
TMhelix
266  -  288
outside
289  -  312
TMhelix
313  -  335
inside
336  -  347
TMhelix
348  -  370
outside
371  -  379
TMhelix
380  -  402
inside
403  -  501
 
 

Population Genetic Test Statistics

Pi
192.928262
Theta
149.457627
Tajima's D
1.388237
CLR
0.351538
CSRT
0.761661916904155
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号