SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04242
Pre Gene Modal
BGIBMGA014260
Annotation
PREDICTED:_metabotropic_glutamate_receptor_2-like_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.769
 

Sequence

CDS
ATGTTACCCGGCTGCAAGTTTGCTTTACCGCTATTCATCATCATTCTGCAACATTCAGAGATGAAACACTTCGGATATAGTCAGCACTATGCTCCAACACTTGATGAGTCCGAATTTCACAGTAGAACATCGAGGCATCACCTTAGACACAAACATAAGCATAACCCAGAAATCTTGGACCAAACTTTTGTTGCTGACATACCAATATTTGCGAATCTAAAAGGAGTGGGTTTTATCGACAGAGAGTTCAATGAACCGGTATTTAAGAATGGTAAGGACTGGTTGAACATGTCTAGCGACCAGGTTGGAGAGATGAAGGACAAGAAACACCAACATTGGCCAATTAAAAGAGAAGCAGTTATTGAAGGAGATTTGGTACTGGGTGGTTTGATGATGGTGCACGAAAGATCTGATAATATGACCTGTGGTCCTGTGATGCCGCAAGGAGGAGTACAGGCTTTGGAAACTATGCTATACACGTTAGATATCATTAATAATAAGCAGGAGCTAATACCAGGCGTGGTGCTTGGAGCGCATATCTTAGATGACTGTGATAAGGACACGTATGGATTAGAAATGGCCGTAGACTTTATCAAAGGTTCAATAAGCAACATCGATGATGCAGAGTACGCTTGTAATGCGACCGCTGTGCGTAAAGTCATCTCAGGAGTGGTAGGTGCAGCATCCAGTGTGACGTCGGTGCAAGTCGCGAATCTGCTGAGACTGTTCAAAATACCGCAGGTTTCTTTCTTTTCCACATCACCGGAGCTGTCCAACAAAGCCCGTTTCGAGTACTTCACTAGGACAATACCTTCAGACCTTCACCAAGTGCGAGCGATGGTGGAAATCGTGAAGAAACTTGGCTGGAGCTACGTGTCTATTATTTACGAGGAGTCCAGTTACGGTATTAAGGCATTCGAAGAACTTGAAGCGCTTCTGGCTAGAAATGGCATCTGCATAGCTGTCAAAGAGAAGCTGGTAAAGGACTCTGGAGTTGCTGACGAGAAGGCATATGACACGATTGTCCAGAAATTGCTGACTAAGCCCCGGGCTAGAGGTGCAATAATCTTCGGTTCTGATCAAGAAGTGGCTGGTGTAATGAGAGCGGTGATACGTGGCAATGCCACAAGCTCCTTCAGCTGGGTGGGGTCTGACGGCTGGAGCGCGCGGTCTCTGGTGTCCGAAGGCAACGAGCAGGCAGTCGAAGGGACCATCAGCGTCCAGCCGCAAGCGAATGATGTGAGGGGCTTTAAAGAGTACTTTTTGAACCTGAATGTGAAGAACAATAAGAGGAACCCTTGGTTTGTTGAATTCTGGGAAGACCACTTCCAGTGCCGCTACCCAGGTAGTCCCAGAACTCCGTACAATGGGCAGTATTCCAAGACCTGCTCTGGACTTGAACGCCTTACCACCGAGAACACTGAGTTTGAGAGGCAATTGCAGTTCGTTTCTGATGCTGTGATGGCCTTCGCTTATGCTATACAGTAA
Protein
MLPGCKFALPLFIIILQHSEMKHFGYSQHYAPTLDESEFHSRTSRHHLRHKHKHNPEILDQTFVADIPIFANLKGVGFIDREFNEPVFKNGKDWLNMSSDQVGEMKDKKHQHWPIKREAVIEGDLVLGGLMMVHERSDNMTCGPVMPQGGVQALETMLYTLDIINNKQELIPGVVLGAHILDDCDKDTYGLEMAVDFIKGSISNIDDAEYACNATAVRKVISGVVGAASSVTSVQVANLLRLFKIPQVSFFSTSPELSNKARFEYFTRTIPSDLHQVRAMVEIVKKLGWSYVSIIYEESSYGIKAFEELEALLARNGICIAVKEKLVKDSGVADEKAYDTIVQKLLTKPRARGAIIFGSDQEVAGVMRAVIRGNATSSFSWVGSDGWSARSLVSEGNEQAVEGTISVQPQANDVRGFKEYFLNLNVKNNKRNPWFVEFWEDHFQCRYPGSPRTPYNGQYSKTCSGLERLTTENTEFERQLQFVSDAVMAFAYAIQ

Summary

Similarity
Belongs to the G-protein coupled receptor 3 family.
EMBL
BABH01032726    BABH01032727    KZ150080    PZC73882.1    KQ460211    KPJ16524.1    + More
KQ459302    KPJ01848.1    AGBW02014793    OWR41061.1    KQ976749    KYN08785.1    KQ982691    KYQ52223.1    KQ980765    KYN13374.1    KQ976641    KYM78799.1    KQ435036    KZC14082.1    OUUW01000001    SPP73687.1    KQ981272    KYN43846.1    CH940648    EDW60858.2    CH479181    EDW31631.1    KZ150487    PZC70703.1    CM000071    EDY68791.2    AE013599    AGB93339.1    CM000157    EDW89357.2    GDHF01030797    JAI21517.1    ACL83073.1    CH902619    KPU75778.1    CM002911    KMY92273.1    KMY92274.1    KMY92275.1    KRT01640.1    AAF59082.3    CH916367    EDW00818.1    KMY92276.1    NWSH01001473    PCG71140.1    AJ581534    CAE46392.1    CH954177    EDV59512.1    KRJ98364.1    CH480816    EDW46948.1    EDV35656.2    AAF59081.3    CH933808    EDW10117.2    KQS70875.1    AB161182    BAD08344.1    AJWK01002248    KU986887    APC26116.1    KU986890    APC26119.1    AXCM01007183    AXCM01007184    GEHC01000817    JAV46828.1    ACPB03010517    JTDY01002016    KOB72318.1    CVRI01000074    CRL08038.1    GAMC01002043    JAC04513.1    ATLV01024163    KE525350    KFB50889.1    AAAB01008900    EAA09380.4    AXCN02002332    CH963849    EDW74207.1    ODYU01005102    SOQ45645.1    CH477615    EAT38269.2    LRGB01000568    KZS17936.1    GDIP01189915    JAJ33487.1    GDIP01037990    JAM65725.1    GDIQ01159366    JAK92359.1    GDIQ01139066    JAL12660.1    GDIP01039190    JAM64525.1    GDIQ01044505    GDIQ01044504    JAN50233.1    GDIP01201161    JAJ22241.1    GDIP01194017    GDIP01192215    JAJ31187.1    GDIP01194016    GDIP01192214    JAJ29386.1    GDIQ01136566    JAL15160.1    GDIQ01046503    JAN48234.1    GDIP01084891    JAM18824.1    GDIP01084890    JAM18825.1    GDIQ01214878    GDIQ01109465    JAL42261.1    GDIP01199866    JAJ23536.1    GDIQ01157461    JAK94264.1    GDIP01206564    JAJ16838.1    GDIP01166826    JAJ56576.1    GDIP01093580    JAM10135.1    GDIP01204511    JAJ18891.1    GDIP01093578    JAM10137.1    GDIQ01160960    GDIQ01160959    JAK90766.1    GDIQ01159361    JAK92364.1    GDIQ01159362    JAK92363.1    GDIQ01136563    JAL15163.1    GDIQ01159360    JAK92365.1    GDIQ01160961    JAK90764.1    GDIP01199865    JAJ23537.1    GDIQ01159359    GDIQ01157464    JAK92366.1    GDIP01166825    JAJ56577.1    GDIP01189914    JAJ33488.1    GDIQ01139068    JAL12658.1    GDIP01189917    JAJ33485.1    GDIP01206563    JAJ16839.1    GDIQ01139069    GDIQ01136569    JAL15157.1    GDIQ01139071    JAL12655.1    GDIP01105823    JAL97891.1    GDIP01110231    GDIP01061384    JAL93483.1   
Pfam
PF01094   ANF_receptor        + More
PF07562   NCD3G
PF00003   7tm_3
Interpro
IPR028082   Peripla_BP_I        + More
IPR000337   GPCR_3       
IPR001828   ANF_lig-bd_rcpt       
IPR000162   GPCR_3_mtglu_rcpt       
IPR017978   GPCR_3_C       
IPR038550   GPCR_3_9-Cys_sf       
IPR017979   GPCR_3_CS       
IPR011500   GPCR_3_9-Cys_dom       
SUPFAM
SSF53822   SSF53822       
Gene 3D
PDB
2E4Y     E-value=3.87649e-73,     Score=700

Ontologies

Topology

Subcellular location
Cell membrane  
Length:
495
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0421900000000001
Exp number, first 60 AAs:
0.0122
Total prob of N-in:
0.00215
outside
1  -  495
 
 

Population Genetic Test Statistics

Pi
251.295779
Theta
158.657919
Tajima's D
1.338229
CLR
0.309405
CSRT
0.749712514374281
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号