SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04241
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.13
 

Sequence

CDS
ATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCAGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTATCTTCTTCGACGTCGCAAAAGCGTTCGATAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATGTTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTCTTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTTCCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERQLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGAIFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDVPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLFPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    AF081101    AAC72919.1    KQ459580    KPI99178.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    ABLF02008933    ABLF02042518    ABLF02057746    ABLF02014862    ABLF02014866    ABLF02061908    KQ973342    KXZ75569.1    GGMS01000737    MBY69940.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMS01012005    MBY81208.1    ABLF02003961    ABLF02059872    GGMR01016114    MBY28733.1    GGMS01004685    MBY73888.1    GEZM01038405    JAV81653.1    GGMS01008766    MBY77969.1    ABLF02033757    KK117880    KFM71667.1    GGMR01018716    MBY31335.1    AF012049    AAC24972.1    GBBI01004395    JAC14317.1    GGMR01003407    MBY16026.1    GFTR01008038    JAW08388.1    GGMS01002955    MBY72158.1    GGMR01000676    MBY13295.1    GGMS01006359    MBY75562.1    GBBI01004571    JAC14141.1    GALX01005300    JAB63166.1    NEVH01002704    PNF41489.1    NEVH01006736    PNF36716.1    GEZM01053022    JAV74219.1    NEVH01000269    PNF43694.1    GGMS01017914    MBY87117.1    NEVH01020940    PNF20481.1    ABLF02020655    ABLF02039168    ABLF02061060    GFXV01006424    MBW18229.1    NEVH01017542    PNF24034.1    ABLF02024246    GFXV01000774    MBW12579.1    GGMR01004661    MBY17280.1    NEVH01006721    PNF37225.1    GFXV01007093    MBW18898.1    ABLF02008463    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NWSH01000032    PCG80497.1    GGFJ01001857    MBW50998.1    NEVH01026386    PNF14434.1    GGFJ01001858    MBW50999.1    GBBI01001646    JAC17066.1    ABLF02034467    GBYB01008290    JAG78057.1    NEVH01012089    PNF30491.1    KL813758    KFM83187.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01007393    PNF35987.1    NEVH01022639    PNF18527.1    NEVH01003017    PNF40781.1    NEVH01007578    PNF35646.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01007443    PNF35684.1    RPOV01000134    RPJ78669.1    NEVH01026106    PNF14658.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01014053    MBY26672.1    GBGD01000880    JAC88009.1    GGMS01017365    MBY86568.1    LBMM01010106    KMQ87671.1    NEVH01020071    PNF21969.1    NEVH01016302    PNF25823.1    ABLF02037660    NEVH01010546    PNF32261.1    PYGN01000192    PSN51582.1    KK113014    KFM59099.1    LBMM01014395    KMQ85192.1    GBGD01000799    JAC88090.1    NEVH01005938    PNF38077.1    NEVH01011193    PNF32021.1    GGMS01001277    MBY70480.1    NEVH01023961    PNF17613.1    PCG80496.1    NEVH01001355    PNF42855.1    NEVH01021205    PNF19912.1    GEZM01084969    JAV60363.1    GGMR01010373    MBY22992.1    NEVH01000280    PNF43672.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    AY060438    AAL25477.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
512
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
15.60247
Exp number, first 60 AAs:
12.86793
Total prob of N-in:
0.43959
POSSIBLE N-term signal
sequence
outside
1  -  512
 
 

Population Genetic Test Statistics

Pi
45.260368
Theta
32.40162
Tajima's D
2.959471
CLR
0.004462
CSRT
0.976951152442378
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号