SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04221
Pre Gene Modal
BGIBMGA014260
Annotation
PREDICTED:_metabotropic_glutamate_receptor_2-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 3.836
 

Sequence

CDS
ATGAGTGCGGCGGCTCGCGTGCTGCTGGCGACGCTGCTGGCGACGGCGGCCCTCGCCTCGCACGCTGACCGCACCCACCTCGCCAACATCAGCTCCGCTCTGACCAACCCCACGACTCAGCTGTTCTATGATGACTTGCTTCCTTCTCATATACTCAGAAGTAAAAGAAACGCACACACCCTCATTGCCACTTTCGATATTTCAAAGATCTTCAAGAGAAAGAAGCTGCAGAGCAAGCAAGGGGACTCGCCAAACCCTACTCCCTCCTCCCTCCTCTCCGACAACCTGTCCGCCAGTATGGTCGCTGAGCTGCTGGCCACGAGCCTCGCCAATGTGTCTCTGGTCGTCGACACCACTCCACTCACTGATCCGATAGAACTCACCACTTCACTGGTCTCAAACAGTACTATCTCTACGAAAAGAGTCTCTACACCCTTCACACAAATTTCGAATCCGAAAAATTCCTTGAAACTTAAAAGTAAAAGTGAATCGAAGGGTGTCGATGCTAGCGTGTCGTCACGAGTTGGAGTCAAGAAGAAGGTATGGGAGAACGAGACGGTGTGGCCCGTGAAGCACGCCGCCGTTGTCGACGGAGACATCATCCTCGGCGGACTCATGATGGTCCACCGTCGGTCGGAGGTGGCGACGTGCGGGCCAGTGATGGCGCAGGGCGGCGTGCAGGCGCTCGAGGCGATGCTGTTCGCGCTGGACGCGGCGCGGGCCCTCGCCCCGCCCGCCGTCAGCCTCGGCGCACACGTCCTAGACGACTGCGACAACGACACCTATGGATTAGAAATGGCGCTCGACTTCATCAAAGGTTCCATCAGCAACATCGACGACGCGGAGTACGCTTGCAACGCGAGTGCCGTGCGGAAGGTCATCTCCGGAGTGGTGGGCGCGGCTTCCAGTGTCACGTCCGTGCAAGTCGCTAACCTGTTGCGACTGTTCAAGATACCGCAGGTATCATTTTTTTCGACTTCTCCAGAGCTTTCGAACAAAGCTCGATTTGAATACTTTACTAGAACTATTCCATCTGACCTTCACCAAGTGCGGGCTATGGTAGAGATAGTCAAGAAATTGGGCTGGCGCTATGTTTCTATCATTTACGAAGAATCCAACTACGGCATTAAGGCTTTTGAAGAACTGGAAACTTTACTGGCACGCAATGAGATCTGTATCGCGGTGAAGGAGAGGCTGGTAAAAGATTCGGGGGAGGCGGACGAGCGAGCTTACGACAACATCGTGGCGCGTCTCCTGTCGCGACCGCGGGCCCGAGGAGTGATCGTGTTCGGCTCGGATCAAGAAGTGGCAGGCGTGATGGCGGCGGTGGCTCGCGCGGGGGCCACCGGAGCCTTCAGCTGGGTCGGCTCGGACGGCTGGAGCGCTCGGGCGCTGGTCTCGGACGGAAACGAGGAGGCCGTCGAGGGAACTATCAGCGTCCAGCCCCAGGCTAACCCTGTGCGCGGCTTCAAGGAGTACTTCCTCAACCTCACCGTAGAGAACAACCCGAGGAACCCCTGGTTCGTAGAGTTCTGGGAGGATCAGTTCCGGTGTCGATACCCGGGCAGCGCCCGCACGCCCTACAACGCTCAGTACTCGCGGCTGTGCTCGGGGCGGGAGCGACTCTCCGCAGGGAACATAGAGTTCGAGGCTCAGCTGCAGTTCGTCACCGACGCCGTGCTTGCGTTCGCGCACGCCATTAGAGACATGCACGCGGACCTGTGCGGAGGAGAGCCGGGACTGTGCGAGGCGATGCGACCCGCCAGCGGACCGACGCTGTTGCGCTACCTGCGACAAGTTCGCTTCACAGGTCTGAGCGGGGATGAGTTCCACTTCGACAGCAACGGCGACGGCCCCGCGCGATACAACATCCTGCACTTCAAGCAGCTGTCGCCCGGGGTCTACCGCTGGCTGAAGGTCGGCCGCTACCTCGACGGAGAGCTCGAACTGGACATCGACGATATCCAGTTCAAGTGGGAATCAGCCCGACCCCCGGAGTCGGTGTGCAGCGTGGAGTGCGAGCTCGGACAAGCCAAGCAGTATGTGGAGGGTGAGAGCTGCTGCTGGCATTGCTTCAACTGCACGCAGTACGAGGTCCGGTCGCCGAGCTCGGAGACGGCGTGCGTGGAGTGCGCGCTGGGCACGCTGCCGGACCCGCGCCGGATGCGGTGCGCGCCCGTGCCGGAGCTCTATCTGCGACCCGACTCTGCTGCCGCTGTCGCCGCTATGACTTTCTCTTCCCTTGGAATCATCCTCACAGTGTTCGTGGTGTGCGTGTGGGCGGCGCGCGGCTCGACGCCGGTGGTGCGCGCCAGCGGCCGGGAGCTGTCGCTGGTGCTGCTCGCGGGGATCCTCATGTGCTACCTCGTCACCTTTGCACTCGTCTTCAGACCAACAGATGTTCTCTGCGCTCTTCAGCGTTTCGGCACCGGGTTCTGCTTCACGGTGGTGTATGCGGCGCTGCTCACAAAGACCAACCGCATCGCTCGTATCTTCGCAGCCAGCAAGCACTCCGCGCGCCGACCCTCGCTCATCTCGCCCAAGTCGCAGCTGCTCATCTGTTCTGCCCTCGTATCTGTCCAGGTGGTGATAGTGGTGGTGTGGCAGATAGTGTCACCGGCGCGCGCCATACATCACTACCCGACGCGCGAAGACAACATGCTGGTCTGCGACTCATACGTGGATGCGTCCTACACCATCGCCTTCTTCTACCCCGTGGTGCTCATCCTGGTGTGTACAGTATACGCCGTTCTGACGCGCAAGATACCAGAAGCCTTCAACGAAAGCAAACACATAGGGTTCACCATGTACACGACGTGCGTGATCTGGCTGGCGTTCGTGCCGCTGTACTTCGGGACGGCGAGCCACGTGCCCCTGCGCGTCACCAGCATGGCCATCACGATATCGCTCAGCGCCAGCGTCACGCTCGTCTGCCTGTTCTCGCCGAAGGTGTATATAATCCTGGTGCGTCCGGAACGAAACGTGCGTGCAAGCCTGATGCCGACGCGATGGAGGGGAGGGGTGAGGGGCGGCGCGGCGGGAGGGGCGGTGTGCGCGGCGCTGGTCGGCACCGCTCCCCTCCCTCGCGCACCCGACCTTACACCCTCCACCGACCTTTCCACCTTGAACGAACCTGAGCGCTCGTCAACGGATCGTCAAGTGCAGACGGAGGAGGAGTCGGAGCTGTACCCGCGTCTGCGTCGCGCGGTGGAAGAGAACGGCGTTCGGCTGGACGCGCGGCAATTAGAGGCGCTGCGGGCCGGGCTGCCGGCGTTCGGTGCTGGAGGTTCGGCGCCGCCCTCGGCCGAGCTGGCCGTGGCGGTGCTCGGCGCGGACCTGCCCTTATAG
Protein
MSAAARVLLATLLATAALASHADRTHLANISSALTNPTTQLFYDDLLPSHILRSKRNAHTLIATFDISKIFKRKKLQSKQGDSPNPTPSSLLSDNLSASMVAELLATSLANVSLVVDTTPLTDPIELTTSLVSNSTISTKRVSTPFTQISNPKNSLKLKSKSESKGVDASVSSRVGVKKKVWENETVWPVKHAAVVDGDIILGGLMMVHRRSEVATCGPVMAQGGVQALEAMLFALDAARALAPPAVSLGAHVLDDCDNDTYGLEMALDFIKGSISNIDDAEYACNASAVRKVISGVVGAASSVTSVQVANLLRLFKIPQVSFFSTSPELSNKARFEYFTRTIPSDLHQVRAMVEIVKKLGWRYVSIIYEESNYGIKAFEELETLLARNEICIAVKERLVKDSGEADERAYDNIVARLLSRPRARGVIVFGSDQEVAGVMAAVARAGATGAFSWVGSDGWSARALVSDGNEEAVEGTISVQPQANPVRGFKEYFLNLTVENNPRNPWFVEFWEDQFRCRYPGSARTPYNAQYSRLCSGRERLSAGNIEFEAQLQFVTDAVLAFAHAIRDMHADLCGGEPGLCEAMRPASGPTLLRYLRQVRFTGLSGDEFHFDSNGDGPARYNILHFKQLSPGVYRWLKVGRYLDGELELDIDDIQFKWESARPPESVCSVECELGQAKQYVEGESCCWHCFNCTQYEVRSPSSETACVECALGTLPDPRRMRCAPVPELYLRPDSAAAVAAMTFSSLGIILTVFVVCVWAARGSTPVVRASGRELSLVLLAGILMCYLVTFALVFRPTDVLCALQRFGTGFCFTVVYAALLTKTNRIARIFAASKHSARRPSLISPKSQLLICSALVSVQVVIVVVWQIVSPARAIHHYPTREDNMLVCDSYVDASYTIAFFYPVVLILVCTVYAVLTRKIPEAFNESKHIGFTMYTTCVIWLAFVPLYFGTASHVPLRVTSMAITISLSASVTLVCLFSPKVYIILVRPERNVRASLMPTRWRGGVRGGAAGGAVCAALVGTAPLPRAPDLTPSTDLSTLNEPERSSTDRQVQTEEESELYPRLRRAVEENGVRLDARQLEALRAGLPAFGAGGSAPPSAELAVAVLGADLPL

Summary

Similarity
Belongs to the G-protein coupled receptor 3 family.
EMBL
KZ150487    PZC70703.1    NWSH01001473    PCG71140.1    AGBW02008952    OWR52095.1    + More
KQ460211    KPJ16524.1    KZ150080    PZC73882.1    KQ459302    KPJ01848.1    CH902619    KPU75778.1    CM002911    KMY92273.1    KMY92274.1    KMY92275.1    CM000071    KRT01640.1    CM000157    KRJ98364.1    CH933808    EDW10117.2    GDHF01030797    JAI21517.1    EDV35656.2    AE013599    AAF59081.3    CH916367    EDW00818.1    CH954177    KQS70875.1    AGB93339.1    CH940648    EDW60858.2    ACL83073.1    AJ581534    CAE46392.1    KMY92276.1    EDW89357.2    OUUW01000001    SPP73687.1    AAF59082.3    EDV59512.1    CH479181    EDW31631.1    CH480816    EDW46948.1    KQ435036    KZC14082.1    EDY68791.2    AB161182    BAD08344.1    KQ976641    KYM78799.1    CH963849    EDW74207.1    KQ980765    KYN13374.1    AJWK01002248    KQ982691    KYQ52223.1    KQ976749    KYN08785.1    GAMC01002043    JAC04513.1    JTDY01001683    KOB73168.1    KQ981272    KYN43846.1    CVRI01000074    CRL08038.1    GDHF01016218    JAI36096.1    ATLV01024163    KE525350    KFB50889.1    AAAB01008900    EAA09380.4    ACPB03010517    GEHC01000817    JAV46828.1    GGMR01016299    MBY28918.1    GFXV01003936    MBW15741.1    APCN01002995    CH477615    EAT38269.2    KU986890    APC26119.1    KU986887    APC26116.1    GDIQ01152312    JAK99413.1    GDIQ01152309    JAK99416.1    GDIQ01155159    JAK96566.1    GDIQ01152306    JAK99419.1    GDIQ01044510    GDIQ01044509    JAN50227.1    GDIP01105826    JAL97888.1    GDIP01206565    GDIP01061385    JAM42330.1    GDIQ01160960    GDIQ01160959    JAK90766.1    GDIQ01159361    JAK92364.1    GDIP01208214    GDIP01070778    JAJ15188.1    GDIP01110233    GDIP01061387    JAM42328.1    GDIQ01159358    JAK92367.1    GDIP01201160    JAJ22242.1    GDIQ01152307    JAK99418.1    GDIQ01159359    GDIQ01157464    JAK92366.1    GDIQ01157466    JAK94259.1    GDIP01078631    JAM25084.1    GDIP01093581    JAM10134.1    GDIQ01073442    JAN21295.1    GDIQ01155162    JAK96563.1    GDIP01199863    JAJ23539.1    GDIQ01155160    JAK96565.1    GDIQ01152311    JAK99414.1    GDIQ01136563    JAL15163.1    GDIQ01159360    JAK92365.1    GDIQ01152310    JAK99415.1    GDIQ01139070    JAL12656.1    GDIQ01155105    JAK96620.1    GDIQ01152313    JAK99412.1    GDIQ01122016    JAL29710.1    GDIQ01136567    JAL15159.1    GDIP01103029    GDIP01103028    JAM00686.1    GDIP01199864    JAJ23538.1    GDIP01202362    JAJ21040.1    GDIQ01155107    JAK96618.1   
Pfam
PF01094   ANF_receptor        + More
PF07562   NCD3G
PF00003   7tm_3
PF00176   SNF2_N
PF00271   Helicase_C
PF13892   DBINO
Interpro
IPR038550   GPCR_3_9-Cys_sf        + More
IPR017978   GPCR_3_C       
IPR000162   GPCR_3_mtglu_rcpt       
IPR001828   ANF_lig-bd_rcpt       
IPR000337   GPCR_3       
IPR011500   GPCR_3_9-Cys_dom       
IPR028082   Peripla_BP_I       
IPR017979   GPCR_3_CS       
IPR000330   SNF2_N       
IPR027417   P-loop_NTPase       
IPR038718   SNF2-like_sf       
IPR014001   Helicase_ATP-bd       
IPR020838   DBINO       
IPR001650   Helicase_C       
SUPFAM
SSF53822   SSF53822        + More
SSF52540   SSF52540       
Gene 3D
PDB
6N52     E-value=5.53488e-150,     Score=1366

Ontologies

Topology

Subcellular location
Cell membrane  
SignalP
Position:   1 - 22,         Likelihood:  0.983697
 
 
Length:
1115
Number of predicted TMHs:
8
Exp number of AAs in TMHs:
170.84575
Exp number, first 60 AAs:
0.53213
Total prob of N-in:
0.03054
outside
1  -  737
TMhelix
738  -  760
inside
761  -  772
TMhelix
773  -  795
outside
796  -  804
TMhelix
805  -  822
inside
823  -  848
TMhelix
849  -  871
outside
872  -  896
TMhelix
897  -  919
inside
920  -  931
TMhelix
932  -  954
outside
955  -  963
TMhelix
964  -  986
inside
987  -  1005
TMhelix
1006  -  1028
outside
1029  -  1115
 
 

Population Genetic Test Statistics

Pi
225.741754
Theta
204.347278
Tajima's D
0.599075
CLR
0.032321
CSRT
0.538223088845558
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号