SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04217
Pre Gene Modal
BGIBMGA014468
Annotation
TRAS3_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 2.868
 

Sequence

CDS
ATGGCACCCGTAATCCCTGAAATAACATTACCCGCGTCTGCAGAGGACATAAACAGTAGGGACACATACCTCGAAACCGTCCGTAAGCTCATATCCTGCATCACAACAGCTGTGACTGAGGGAAAAAGTGTTACCGCAGCCAACAAGCGCCTTATCTGCTCCGCGGCGGAGGAAATTCGTAGGGCGACGAGAGTGTTGGAAACAACACTCGCATCGACACTGACACCACCAACCCCCTCTCCACCTGCCACCAACGAAGGTTTGAAGGAGGAGATTATCGCTTGCGTCAGAGAGGAGTTCAAGCGGCATAGACAACTACCGCCGCTGACCCTTCAATCACAAGTTCGCCCATCGTATGCCCAAGCCGCAGCACCCAACCCCCGGAAACCAGCCCTTACGACCAAACCAACACCCAAAACATATCCAGCTACAAAACCTGCAATTATTGTCTCAGCAAAAACCGAAGTAAAGACGAAACAGGATATTATCGAGGCCTGGAGGCGCAACATCAGCTTCAAAAATTCCGGCTTTGCCCCTAGCAGAGTACAAGCTGTATCAAATAACAAACTAAGAATCGAGTTCGATAACATAGAACAAAGGAACGATACCCTCACTCGTATCACTAACTCCCAGACAATTCACGCCGAACCCGCTCGCAGGCTGCTGCCTATGCTCAATCTCAAGGGAGTCTCCAAAGACGTTCCCGCTGAAGATCTAGTGAGCATAATCAGCAGACAGAACCCGGAACTCACTAACGCAATCAACCAAAAGGAGGACTTGCGGTTCCGTTTCCAGCGCTCCAACAGAAACCCCAACTTATATAACGCCATCCTAATTGCACAGCCAACTGTCTGGCGTAAGTGTATAAGCCTGGGCAGAATCAGTGTGGACCATCAACGTATTCACGTAGAGGAGTTCACACCGTTCCTGCAGTGTCACAAGTGCCTTAGCTTCGGCCACACTAAAAACAAGTGTTCGTCCACCGAACAATACTGTGCACACTGCAAATCGATTATGGCACCGATTAACTCCGTGAAATTCCTACAGTGCAATGTGGATAAGTCAAAAAACAGTTGGCACGAATTTCTAGTCTCCTTCACCAGCGAACGATATCATTTTGCCCTAATATCCGAACCTTACGTAGGCGCAAATAACGAGGTCAAAAACATCCCCGGAATTAACATTTACCAATTCTCTGACGGCGCGCGTGTCAAGGCCTGCATACTAGCTAAGACAGGTGTCGGCTCAGTCCTCGGCCTATCCCAATACTCTTCGGCAAACCTGTCGGTCATACAGCTAACGGCAGGAAACAAGAAGACGTACATAGCCTCAACGTACATCGAACCCGATGTCGATGCCAACGGCACCATGGAGCGTCTGGAAGTTTTCCTTAAAGACATAGGAGGGGCAAGAGTAATTGTGGGAGGTGACTTCAATGGATGGCACCCATCGTGGGGGAGCGTGAGGGTGAACCCCAGAGGCTCATCACTAGTCGAACTAGCGCACAGCAACGATTTATACATTTGTAACTCAGGAGACACTCCAACCTTCGAAACCATCACTCATGGCCGCAATAGATCATCCATCATCGACCTTACTCTTGCATCCAGCGACCTCTTCAACAGCATCTCTGAATGGCACGTAAATCTTAACACATGCCCCACCTCCCAACACAACGCCATTGAATTCTCACTTAACACCAACGAAAACACAAATAAACACGCAGAAAACACTTCCACATTCCTATACAAGTCGGAACAAGCCAATTGGACAATATTTAGAAACACCCTCCACACTCTTATGGCCAACACAGACATCCTTGATAGGAGCGTTGAAAGCTTAAGCCCAGAGGGACTTGAGTCGCTCCTTCGGGAAGTCACGGACATCCTACACCGGGCCTGTAGGGCATCGATGCGAGTAAAAGCAGGCTCTGGGAATAGACACAAGCCGCCTTGGCTCACTGGGAAAACTGAATTCCTCCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACAATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATTTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTTCATAGACTGGGTAAAGGGACACTCGGGTATCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCACACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTCAACAAATGCACACAAACAAACTTTCAGCTTACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACTTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGTGTTCGCTGCGAAAAGGCACAGCCACGAAGAAACGTGCCACGAAGTACAGGTGTCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACTTCGTTTTGCCAAACAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MAPVIPEITLPASAEDINSRDTYLETVRKLISCITTAVTEGKSVTAANKRLICSAAEEIRRATRVLETTLASTLTPPTPSPPATNEGLKEEIIACVREEFKRHRQLPPLTLQSQVRPSYAQAAAPNPRKPALTTKPTPKTYPATKPAIIVSAKTEVKTKQDIIEAWRRNISFKNSGFAPSRVQAVSNNKLRIEFDNIEQRNDTLTRITNSQTIHAEPARRLLPMLNLKGVSKDVPAEDLVSIISRQNPELTNAINQKEDLRFRFQRSNRNPNLYNAILIAQPTVWRKCISLGRISVDHQRIHVEEFTPFLQCHKCLSFGHTKNKCSSTEQYCAHCKSIMAPINSVKFLQCNVDKSKNSWHEFLVSFTSERYHFALISEPYVGANNEVKNIPGINIYQFSDGARVKACILAKTGVGSVLGLSQYSSANLSVIQLTAGNKKTYIASTYIEPDVDANGTMERLEVFLKDIGGARVIVGGDFNGWHPSWGSVRVNPRGSSLVELAHSNDLYICNSGDTPTFETITHGRNRSSIIDLTLASSDLFNSISEWHVNLNTCPTSQHNAIEFSLNTNENTNKHAENTSTFLYKSEQANWTIFRNTLHTLMANTDILDRSVESLSPEGLESLLREVTDILHRACRASMRVKAGSGNRHKPPWLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIFIDWVKGHSGIIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIHTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQLTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQVFAAKRHSHEETCHEVQVSPYNLPEMLKKKAAINSFTSFCQTIINNIKKINENN

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.46956e-23,     Score=275

Ontologies

Topology

Length:
995
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00314
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  995
 
 

Population Genetic Test Statistics

Pi
246.889384
Theta
169.355526
Tajima's D
1.990581
CLR
0.025947
CSRT
0.88035598220089
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号