SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04213
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like?_partial_[Papilio_polytes]
Location in the cell
Nuclear   Reliability : 3.832
 

Sequence

CDS
ATGGAACACGCGCGTCCTCCAGCAGAATTATCACTCGATGGCGGTCCGGCTGCACGCTCCGAGGCGTGGCGGCAATGGCGGAAGCTGTTCGAAGTATTTCTTAAAGCGTCTGGAGTGAGCAAAGAGCCTAAAGAAGTTCAGGCTAGTTTGTTGGTGAATCTCATAGGATCGGCCGGTTACGAGGTTTATACGACCTTCACTTTTAACGAAGGTGAAAGTGAGGACGATATCGGCTGTGTTCTGAATAAGTTCGACAAGTACTTTGGAGCAAAACCGAATATCATAGTAAGACGGTATAAGTTCTTCACCCGTGATCAAGAAGATGGCGAAAATATTGACCAATACATAACCGCATTGAGGGTACTCAGTCAGCAATGCGAATTCAGTGAATTACACGAAAGCTTGTTACGTGATCGTATCGTATGCGGTGTCAATAACAACACGGTGAGAGATCGACTTCTTCGCACTGATGATCTTACACTAGTGAAGGCCTTACAACTCTGTCAGGCGGCCGAGATGTCTAAAGAGGACAGTAAATACATTAACTGCGCTGCGGACAGTGTGCAGGTGTCTGCAGTTCAGAACAGAAGCGGTGAACGAAGCGGTCAGCGCGCGAGAGGAGTACGCGGCGCAAGAGTTGGCAGTAACGGCGGGCAGAGAACAGCTCGCAGCGCCTGTCAGCGATGTGGAAACAGCCGGTGTCTAGGCGGTGAACGTTGTCCAGCAGTTAACGCGATGTGTTTTGTGTGCGATCAGAAAGGGCATTTTTCGCGAGTATGTGTGCAAAAGAAAGCGATTCGTAAGGTATTAAATTTGAGTATGGATACTGCGAGCAGTGATAGTGAAGAAAAATGCAAAGAAATGTTCTATGTGAATACGATCGCGGGGAACAATAACATATACTTGTTTCAAGGTCTAGGAAAATTACCTGGTAAATATAGTATTGTAATAAATAAAAACATACAGCCTGTTGTTAGTCCAACGAGAAAAATTCCCTTAGGAATTAAAGGTAAATTGTTGGACGAGTTACGTAGAATGGAAGAGTTAGGTGTGGTTAGAAAGGTCACACACCCGACCGATTGGGTGAATGCAATTGTTTTAATCGCAAAAAAGGACGGTGGCATTCGTGTATGTTTAGACCCCCGTCCGCTGAACCGCGCGGTGCGGCGCGCCCAGTATACGTTGCCGACAGTGTCTGAGCTGGCAGCGCGTCTGCGCGGTGCCACTGTGTTCAGCGTGCTCGACGCGCGCTGTGGGTTCTGGATGGTACAGATAGACGACGCCAGCGCCGATCTGTGCACCTTCGGTACTCCGTTTGGCCGGTATCAATTTTTACGTTTACCGTATGGGATAAACTGTGCGCCTGAAGTGTTTCATGCTAAACTCAGGCAGCATTTGGAAGACTTAGATGGTGTGGAGTCTTTCATCGATGACGTCATAATATGGGGACGCACAAAGGAAGAGCATGATAGGAGGTTGGAGTGCCTTTTACAGCGTGCTAAGGAAGTAGGCATAAAGTTTAATCGCGATAAATGTAAATTCGGTGTACCCGAAATTACTTACCTAGGTCATAAGTTCGATGCGAATGGTATGCGGGCAGATGACTCAAAAGTCAAAGCTATTTTAGAAATGCCTTATCCGAAAGATAGGAAGGCGTTAGAGAGATTTTTAGGCATGGTTAATTATTTAGCTAAATTTATTTCTAATTACTCTGAGAGTGTGAATGTGTTACGGACCTTACTGAAAAAGGAATCCGAGTGGTTCTGGGAATCGCATCATTCCGAAGCTGTGGACAAGCTAAAAATGAAGCTTAGCCGTGCGCCCGTGCTGGCACTGTACAGTGAGAGTGTACCGATAGTAGTGTCGGTGGACGCATCCAGTGTGGCGCTGGGTGCCGTGCTGCTACAGGACGGTCGTCCGGTAGAGTTCGCATCACTCACGCTCACCGACACTCAGACTAGGTATGCACACATAGAAAAAGAAATGCTAGCTATTGTGTTTGGGATTGAGCGGTTCAGGCAGTATATTTACGGTAGGTCCGACGTAACCGTACATACTGATCACAAGCCCCTAGAAGCATTATTCAACAAACCACTAGTTTCGGTTCCAGCTCGGTTGCAGAGGATGATGATGAGAGTGCAAGGGTATGATTTCAAAGTTGTATATACTCCGGGTAAAAATATGTATATTGCAGATACGCTATCTCGGGCTCCTTTGAATGAAATGATGAATGATCGGGTTTCTTCTGAAGTTAACGTGCAGACGTGTTTCATGACAGAAAATATACCGTATAGTAACAAAAAGTTGGAGGTAATTAGAAAAGAAACGGAGACGGACAGTGATTGTCGGTGTTTAATTAAGTACATAAAGCATGGCTGGCCAAAAAATAGACGTGATGTAAATGACAAAATAAAAGTGTTCTGGCCGTATCGCGAGGAACTTCATTATATAGAAGGGATTATTTTCAAGGGGGAACGTGTCTTTATACCCCGTGCTTTACGAGACGACATGTTGTTGAGGGTCCACGAGGGACATTTAGGTATCGAAAAATGCAAACGACGCGCGCGTGAAGTAATGTTTTGGCCCGGACTGTCTGAGGATGTGGAGCGAGAGGTGCGGCGGTGCGCAGCGTGTGCGTTACACGCGCCTCGACCGCGCCGGCAACCGCTTCTACAGCACCCTGTGCCCGCGCTACCCTGGCATAAACTAGCCTCCGACATTTTTGAATATAGAAAGAAAAGCTATATTATCCTAGTCGATTACTTTTCTAACTACGTAGAAGTCGGACAGTTGGCGAATATTAGCTCTAAGCATGTTATTAATTTTTTGAGGGAACAGTTCGCGCGTCACGGCATTCCAGCACAATTAGTGACTGATAATGGTCCAGCGTACAGCTCACGAGAATTTAGAATGTTCATGCATGATTGGGAAGTACATCATGAGACGTCATCGCCGCATTACCCACAGTCGAATGGTAAAAGTGAAAGGACAGTACAGTGTGTGAAAAATCTGCTTAAAAAATGTATAGATTCAGGTCAGGATTTTTATTTGTCTTTGTTGAATTTTAGAACAACACCACGTAATGGATTGGATTCGCCTGCACAAATTCTCATGGGTAGACGTTTAAATACAAAATTACCAACTACTGCAGAGCTATTAAGGGAAAAAGTAGATAATGAAAGGAATTACAAAGCTATAATGATGAACAGAGAGAAAATTAAAAAACATTATGATAGATCGGCTAAATTGTTAAAACCCTTGTTATCGGGTGATAAGGCGACTCTAATTGGTAACGGCGTTAGGAAACCGGTGACAATAGTGGAAGGTACATCGCAACCTCGCTCCTATATTATCGAAGATGACTGCGGCAGTCGTTTTCGGCGTACTCGAAGTCAGTTGGTTGTGCGTACAACAGACCATAAAAAACGTGAAGGAAAGTCACTGAAACAACCGATTGTAAAAATTGAAAATAGCAGGACACCAACTGTGATTACGACAACTGTTCGTAGGCGTCGACAAAAGTCAATAAGTAGTAGGCAACTGGGAACCAGTATTGACAATGAGAGTGACCCACAAGCAAGTGGACAGGTCAGTCCGACACAGAGCACAACCACCGATATTCAGTCTACTCAACTTGACGTCAGTGACGATTACGATAGTCCAGCTAGCTTTAGTGATCAGTTGTGTGCGCGGTCGCCAGCGTCGCCACCCGCGGTTCCTATTACAAGGTCTAAGGAAAGAACTGCACGAATGCTAAAAGAATTCTTTTTCGAGTGTGATTAG
Protein
MEHARPPAELSLDGGPAARSEAWRQWRKLFEVFLKASGVSKEPKEVQASLLVNLIGSAGYEVYTTFTFNEGESEDDIGCVLNKFDKYFGAKPNIIVRRYKFFTRDQEDGENIDQYITALRVLSQQCEFSELHESLLRDRIVCGVNNNTVRDRLLRTDDLTLVKALQLCQAAEMSKEDSKYINCAADSVQVSAVQNRSGERSGQRARGVRGARVGSNGGQRTARSACQRCGNSRCLGGERCPAVNAMCFVCDQKGHFSRVCVQKKAIRKVLNLSMDTASSDSEEKCKEMFYVNTIAGNNNIYLFQGLGKLPGKYSIVINKNIQPVVSPTRKIPLGIKGKLLDELRRMEELGVVRKVTHPTDWVNAIVLIAKKDGGIRVCLDPRPLNRAVRRAQYTLPTVSELAARLRGATVFSVLDARCGFWMVQIDDASADLCTFGTPFGRYQFLRLPYGINCAPEVFHAKLRQHLEDLDGVESFIDDVIIWGRTKEEHDRRLECLLQRAKEVGIKFNRDKCKFGVPEITYLGHKFDANGMRADDSKVKAILEMPYPKDRKALERFLGMVNYLAKFISNYSESVNVLRTLLKKESEWFWESHHSEAVDKLKMKLSRAPVLALYSESVPIVVSVDASSVALGAVLLQDGRPVEFASLTLTDTQTRYAHIEKEMLAIVFGIERFRQYIYGRSDVTVHTDHKPLEALFNKPLVSVPARLQRMMMRVQGYDFKVVYTPGKNMYIADTLSRAPLNEMMNDRVSSEVNVQTCFMTENIPYSNKKLEVIRKETETDSDCRCLIKYIKHGWPKNRRDVNDKIKVFWPYREELHYIEGIIFKGERVFIPRALRDDMLLRVHEGHLGIEKCKRRAREVMFWPGLSEDVEREVRRCAACALHAPRPRRQPLLQHPVPALPWHKLASDIFEYRKKSYIILVDYFSNYVEVGQLANISSKHVINFLREQFARHGIPAQLVTDNGPAYSSREFRMFMHDWEVHHETSSPHYPQSNGKSERTVQCVKNLLKKCIDSGQDFYLSLLNFRTTPRNGLDSPAQILMGRRLNTKLPTTAELLREKVDNERNYKAIMMNREKIKKHYDRSAKLLKPLLSGDKATLIGNGVRKPVTIVEGTSQPRSYIIEDDCGSRFRRTRSQLVVRTTDHKKREGKSLKQPIVKIENSRTPTVITTTVRRRRQKSISSRQLGTSIDNESDPQASGQVSPTQSTTTDIQSTQLDVSDDYDSPASFSDQLCARSPASPPAVPITRSKERTARMLKEFFFECD

Summary

Pfam
PF00078   RVT_1        + More
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00665   rve
Interpro
IPR000477   RT_dom        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=1.89943e-48,     Score=491

Ontologies

Topology

Length:
1260
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00618999999999998
Exp number, first 60 AAs:
0.00341
Total prob of N-in:
0.00030
outside
1  -  1260
 
 

Population Genetic Test Statistics

Pi
348.328294
Theta
207.945387
Tajima's D
1.842708
CLR
117.703321
CSRT
0.855007249637518
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号