SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04205
Annotation
PREDICTED:_uncharacterized_protein_LOC106138993_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.038 Nuclear   Reliability : 2.032
 

Sequence

CDS
ATGCCTCCTAAGAAGAATAATGATAATGACGAAAGAGAAGACGTTGAGAAGAAAAACGAAGAAGAAAAAATCCCTTACAAGAAAGTGTTATTGAATGGAACAGAGATGGTGGCTTTTATCGATACAGGTAGTGACGCGAACCTTATTATACAATCAGAATTTGAAAAAATTGAAAATTATATCCAACATTATGACAAGAATTCAGAAGTTCGTCTTACGGGTATTGCTAACAAAGAAGTACTTATCAAAGGTGTTTTTACTACTCAGCTACAGATTGATGATGCTGTTACGGATATCAAATTTTACATTGTGGAAGATGATATAATACCTGTAAAGCTGATCATTGGCAACCCCATACTGCGTGAATTCGAAGTTAAGTTTACAAGAAATGGAATTATAATGGAGAAGATACCACTTTGTGCTATTGTTGTTGAGAAGGACGAGGTCAAAGAAGACTACAAGAAATTAAAATTAAGAAAAGAAGATTACAAGAAGTTAGAGAAAGAAGATTATAAGAAGTTAGAGAAAGAAGACTGCAAGAAGTTGGTTAAAGTACCTTACCAGAATCATTTGACACAAAATAGAATACTGTATAAAGAGAAGAATGGAAGTAGTTTTATCGCTGTACCAAAGAAGATGGAAAAAGAAATTATAAGAGAGAATCATAGAAGAGGACGACTAAAAGTTGAAGATTGGGAATGGAGGAGGTCCGATACATACGACTAG
Protein
MPPKKNNDNDEREDVEKKNEEEKIPYKKVLLNGTEMVAFIDTGSDANLIIQSEFEKIENYIQHYDKNSEVRLTGIANKEVLIKGVFTTQLQIDDAVTDIKFYIVEDDIIPVKLIIGNPILREFEVKFTRNGIIMEKIPLCAIVVEKDEVKEDYKKLKLRKEDYKKLEKEDYKKLEKEDCKKLVKVPYQNHLTQNRILYKEKNGSSFIAVPKKMEKEIIRENHRRGRLKVEDWEWRRSDTYD

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
241
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00470999999999999
Exp number, first 60 AAs:
0.00293
Total prob of N-in:
0.15611
outside
1  -  241
 
 

Population Genetic Test Statistics

Pi
181.752442
Theta
141.40373
Tajima's D
0.760936
CLR
1.832549
CSRT
0.592270386480676
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号