SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04189
Pre Gene Modal
BGIBMGA000182
Annotation
PREDICTED:_organic_cation_transporter_protein-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.878
 

Sequence

CDS
ATGCCGGAATCCCCAAAATGGCTAATCTCAGTTGGACGGCTTGAAGAGGCCAGTATTGTTATGACCTCTGCGGCTAAATTCAACAACATCGATCTCCCATCATCAGGTATGTTGTCAGTCGTCGAAACATTGGCCAAAAAGGGAAAAGCTGAAATAAAGACTCAAAGAAAGGCTACTTATATGGACTTGGTCAGATTACCAAGTTTGAGGATTAAGAACTTGTGCTGCTGCGTCGTTTGGCTGGTGATTGGGATAAGCTTTTATGGCGGTACCCAATACTTTGGACAGACCAGTATAAATACATTCTTATCTGTCGCTTTGGGAGGTCTGGTGCAGATCCCTGGGCTACCACTGAGCGCGTATTTCTCGAAAAGATTTGGACGCCGTGTCGCCATCATTGGCATGTTCGTGATTAACTGCATTTGTAACCTGCTATTAGTTCTCCCTGACGCATGGTTTTATCTGAAGCTCGTGGCTGGTTCCATAGCCAACGCTTGCGGAGCTGCTGCGTTTTCTGTAGTTTCTGACATGGACGGTACGAAACGAAAATCAGTTACTATTTCTGAAAAAATAGAAGAGACACCGAAACAAGATGAAGATAAACTGATTCAAGCGATAGGTGAATTCGGGAGATGGCACGTGATGCTAACTATGACGCTATCTGCGCCGATCCGAATGACGGCAGTCTGGAATCATTTGGGAATCATATTTCTGGCACCGAAAACTGAATTTATTTGCGCGGAGAGACGTAATAACAACGAAACCATCCAAGAATCGGAGTGCTACAGCGATTGTACTGAATACGAATACAAAACGGATTTCGTGAATACAATCATTTCTGAATGGGACCTAGTTTGCGATCGAGCCTGGCTGACAAACTTCAATCAGACAGCTTGCATGTCCGGTGTTTTATTGGGCAGTATAGTTTTTGGATTTTTCGCTGATAGATTTGGCCGTCGTCCCGCTCTCCTGACGGCCTGCACCACGCAACTGATAGCTGGATTCACAGCGCCGTTTTGCCCAAATTACATCACATTCACCTTGGTCCGATTCTTCAACGGCGCAGCTGTTGCTGGCGCATTACTGACTTCTTTTATTCTAATGATTGAAACCACGGGCATATCGAAAAGGGAACTAATGAACTGTATCGTTTCCGTGCCTCTGTCGGTGGGAGAAATGATAATGCCAATGTTTTCATATTACTTGAGGTCTTGGACTAGATATAGTTTGGGTCTCGCCCTACCAAATTTGGTATTTTTGGTTTTATTCTTCATTGTACCAGAGTCTCCGAAGTGGTTGATTTCCGTTGGAAGGCTCGAGGAGGCGAGTTTGATCATGACGAAAATAGCGAAATGGAATAGACTTCCAACAGAAGGCATGATGGACAGAGTAAAGATTATAGCATTTGAATCCAATGTTGACGAGCACAAAAACGTCAAGGCAACTTACTTAGACCTGATCAAAGTGCAGGAGATAAGGTGGAAGAATATCGGATGCTGCCTTACGTGGTTTATCCTCGGGCTGAGCTTCTATGGCAGCAATCAGTACATAGGACAGACCAGCCCTAATGTTTTCGTTGCTATTGCAATGGCTGGAGCTATTCAGACTACCTTTGACCCATTCCTTGTTCTATTACTGGCCATAGAGATCGACTTAGCTGGAGGTCTTGAGGCTAATAAACTAATCATAATCGGCCACACGTTAACAGCGAAAAGCTACATGTTCACAACAGAACTCTTCCCGACGGTAGCCAGGAATATGGCGATGGGAGCTTCATCAACGGTCTCCAGAATCGGTTCCATGCTGGCTCCTTTCATCGCTGGTCTTACCGCCACTGGACCTTGGATTCCACCGACTGTGTTCGGCCTTGTACCATTCGCCGCGGCAGTAGCTTGTTACTGTCTACCAGAAACCAGGGGCAAAAAGCTCAAAGATCACTTCGGAGAAACATAA
Protein
MPESPKWLISVGRLEEASIVMTSAAKFNNIDLPSSGMLSVVETLAKKGKAEIKTQRKATYMDLVRLPSLRIKNLCCCVVWLVIGISFYGGTQYFGQTSINTFLSVALGGLVQIPGLPLSAYFSKRFGRRVAIIGMFVINCICNLLLVLPDAWFYLKLVAGSIANACGAAAFSVVSDMDGTKRKSVTISEKIEETPKQDEDKLIQAIGEFGRWHVMLTMTLSAPIRMTAVWNHLGIIFLAPKTEFICAERRNNNETIQESECYSDCTEYEYKTDFVNTIISEWDLVCDRAWLTNFNQTACMSGVLLGSIVFGFFADRFGRRPALLTACTTQLIAGFTAPFCPNYITFTLVRFFNGAAVAGALLTSFILMIETTGISKRELMNCIVSVPLSVGEMIMPMFSYYLRSWTRYSLGLALPNLVFLVLFFIVPESPKWLISVGRLEEASLIMTKIAKWNRLPTEGMMDRVKIIAFESNVDEHKNVKATYLDLIKVQEIRWKNIGCCLTWFILGLSFYGSNQYIGQTSPNVFVAIAMAGAIQTTFDPFLVLLLAIEIDLAGGLEANKLIIIGHTLTAKSYMFTTELFPTVARNMAMGASSTVSRIGSMLAPFIAGLTATGPWIPPTVFGLVPFAAAVACYCLPETRGKKLKDHFGET

Summary

EMBL
BABH01044534    BABH01044535    KZ150304    PZC71520.1    ODYU01003353    SOQ42005.1    + More
NWSH01000158    PCG78950.1    NWSH01003717    PCG65892.1    KZ149948    PZC76718.1    KQ460367    KPJ15486.1    ODYU01002452    SOQ39959.1    NWSH01000020    PCG80714.1    PCG80713.1    AK402884    BAM19447.1    KQ459600    KPI94138.1    BABH01019600    KQ461195    KPJ06789.1    GALX01001195    JAB67271.1    AJWK01002434    AJWK01002435    AJWK01002436    ODYU01006026    SOQ47506.1    KQ459589    KPI97639.1    PCG80708.1    GFDL01008134    JAV26911.1    KQ971342    EFA04007.2    CVRI01000052    CRK99712.1    GEZM01088532    JAV58130.1    GEZM01088533    JAV58129.1    EFA04006.1    DS232350    EDS40471.1    JTDY01000054    KOB79137.1    CH477305    EAT44124.1    JXUM01109993    KQ565372    KXJ71040.1    GAPW01001011    JAC12587.1    ODYU01004551    SOQ44555.1    KQ971381    EEZ97586.2    AXCN02000238    AAAB01008859    EAA07935.5    APCN01000614    AAZX01006832    AGBW02008774    OWR52572.1    KQ461198    KPJ05943.1    KQ434827    KZC07658.1    KQ414775    KOC61282.1    AXCM01003853    KB632314    ERL92208.1    KZ150301    PZC71534.1    NEVH01005889    PNF38331.1    KQ762190    OAD56165.1    GL448504    EFN84558.1    GGFL01004591    MBW68769.1    GGFL01004566    MBW68744.1    NWSH01003004    PCG67121.1    ATLV01018145    KE525215    KFB42743.1    AAZX01002446    KZ288189    PBC34564.1    GL435531    EFN73254.1    KQ459185    KPJ03336.1    KQ435794    KOX73779.1    NNAY01003667    OXU19035.1    APGK01048466    KB741110    ENN73834.1    KZ150029    PZC74769.1    CM000158    EDW91444.1    KRJ99843.1    CH954179    EDV55264.1    KQ980581    KYN15387.1    GL769313    EFZ10529.1    NNAY01000983    OXU25618.1    KQ760085    OAD61975.1    CH480816    EDW48649.1    ADTU01022726    KQ976745    KYM75454.1    GGMS01012221    MBY81424.1    AE013599    AY058478    BT120184    AAF57511.1    AAL13707.1    ADB91432.1    CM000362    CM002911    EDX07862.1    KMY95206.1    KZ288225    PBC31939.1    KQ976914    KYN07128.1    KQ982014    KYN30660.1    KQ978219    KYM96439.1    KQ981673    KYN38256.1    GAKP01006475    JAC52477.1    CH963850    EDW74843.1    RSAL01000008    RVE54031.1    GL435766    EFN72668.1    GL766616    EFZ14896.1   
Pfam
PF00083   Sugar_tr        + More
PF07690   MFS_1
PF00400   WD40
PF12341   Mcl1_mid
PF12894   ANAPC4_WD40
PF03022   MRJP
Interpro
IPR020846   MFS_dom        + More
IPR036259   MFS_trans_sf       
IPR005828   MFS_sugar_transport-like       
IPR005829   Sugar_transporter_CS       
IPR011701   MFS       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR022100   Mcl1_mid       
IPR017986   WD40_repeat_dom       
IPR019775   WD40_repeat_CS       
IPR001680   WD40_repeat       
IPR036322   WD40_repeat_dom_sf       
IPR024977   Apc4_WD40_dom       
IPR011041   Quinoprot_gluc/sorb_DH       
IPR017996   Royal_jelly/protein_yellow       
IPR011042   6-blade_b-propeller_TolB-like       
SUPFAM
SSF103473   SSF103473        + More
SSF50978   SSF50978       
SSF50952   SSF50952       
Gene 3D
PDB
4LDS     E-value=8.1236e-09,     Score=146

Ontologies

Topology

Length:
650
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
251.67201
Exp number, first 60 AAs:
0.04299
Total prob of N-in:
0.98521
inside
1  -  68
TMhelix
69  -  91
outside
92  -  100
TMhelix
101  -  123
inside
124  -  129
TMhelix
130  -  148
outside
149  -  151
TMhelix
152  -  174
inside
175  -  289
TMhelix
290  -  312
outside
313  -  321
TMhelix
322  -  344
inside
345  -  350
TMhelix
351  -  373
outside
374  -  382
TMhelix
383  -  402
inside
403  -  408
TMhelix
409  -  426
outside
427  -  491
TMhelix
492  -  511
inside
512  -  523
TMhelix
524  -  546
outside
547  -  612
TMhelix
613  -  635
inside
636  -  650
 
 

Population Genetic Test Statistics

Pi
268.132969
Theta
203.128772
Tajima's D
1.317097
CLR
0.403903
CSRT
0.748512574371281
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号