SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04187
Pre Gene Modal
BGIBMGA008660
Annotation
PREDICTED:_ubiquitin_carboxyl-terminal_hydrolase_8-like_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.281 Nuclear   Reliability : 1.583 PlasmaMembrane   Reliability : 1.011
 

Sequence

CDS
ATGACGGAAACACGCCGTAAACAATTGCACCTCGGGAAATGCATCGAAGATCTGGACAAATTACACAATGTTCCAGATTTGAAAACGAAACGGGCTAACCTGTTATGCAAGACAGCACAGAAATTGTTTGAAAGCGCCGAAGAAGCTCGGAAAAATGGTGACGAGGAGTACTCCTACGTATATTACATGAAATATTTGAGAGTCATAGCCTATCTGAGCAAAGATAAGGAGTATCTGAAGGATAAGTCATACTACAACAGCATGCTGGGAGCTAAGAACCCTAACAAGGCTATTGATGCTGCTGAGAAACTAAAGAACAGTCTTATAGACAGGTATGCAATGGAATTGAAGCAGAAACGTCTAAACGACATAAAAGAGAATGAGATATTCAAACAAAAGATTGAGGAGAACAGAAAGAAGGCCATTGAGGTCTCCATCAATGAGCCGCCTTCGACACCTGTCAACTTACCAGGTCCTGATGAGGTGACCATCAAAAGCGAACAACTCTATTCAATCTTGAAGGCCGGCAAGTTGAAGGTCATGATCCTTGATGCAAGACCTGGGAAAGATTACTTAGAATCTCACATCAGCTACCCGGCTTGTATCAGTGTGCCCGAAGAATGCATATCACCTGGCAACAACATCGATCTCCCATCATCAGGTATGTTGTCAGTCGTCGAAACATTGGCCAAAAAGGGAAAAGCTGAAATAAAGACTCAAAGAAAGGCTACTTATATGGACTTGGTCAGATTACCAAGTTTGAGGATTAAGAACTTGTGCTGCTGCGTCGTTTGGCTGGTGATTGGGATCAGCTTTTACGGCGGTACCCAATACTTTGGACAGACCAGTATAAATACATTCTTATCTGTCGCTGTGGGAGGTCTGGTGCAGATCCCTGGGCTACCACTGAGCGCGTATTTCTCGAAAAGATTTGGACGCCGTGTCGCCATCATTGGCATGTTCGTGATTAACTGCATTTGTAACCTGCTATTAGTTCTCCCTGACGCATGGTTTTATCTGAAGCTCGTGGCTGGTTCGATAGCCAACGCTTGCGGAGCGGCTGCGTTTTCTGTAGTGTAA
Protein
MTETRRKQLHLGKCIEDLDKLHNVPDLKTKRANLLCKTAQKLFESAEEARKNGDEEYSYVYYMKYLRVIAYLSKDKEYLKDKSYYNSMLGAKNPNKAIDAAEKLKNSLIDRYAMELKQKRLNDIKENEIFKQKIEENRKKAIEVSINEPPSTPVNLPGPDEVTIKSEQLYSILKAGKLKVMILDARPGKDYLESHISYPACISVPEECISPGNNIDLPSSGMLSVVETLAKKGKAEIKTQRKATYMDLVRLPSLRIKNLCCCVVWLVIGISFYGGTQYFGQTSINTFLSVAVGGLVQIPGLPLSAYFSKRFGRRVAIIGMFVINCICNLLLVLPDAWFYLKLVAGSIANACGAAAFSVV

Summary

Uniprot
ProteinModelPortal
PDB
2A9U     E-value=7.97883e-13,     Score=178

Ontologies

GO

Topology

Length:
359
Number of predicted TMHs:
4
Exp number of AAs in TMHs:
73.17616
Exp number, first 60 AAs:
0.00012
Total prob of N-in:
0.99671
inside
1  -  253
TMhelix
254  -  276
outside
277  -  285
TMhelix
286  -  308
inside
309  -  314
TMhelix
315  -  332
outside
333  -  335
TMhelix
336  -  358
inside
359  -  359
 
 

Population Genetic Test Statistics

Pi
259.223617
Theta
167.424787
Tajima's D
1.77153
CLR
234.150215
CSRT
0.845407729613519
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号