SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04186
Pre Gene Modal
BGIBMGA000182
Annotation
PREDICTED:_organic_cation_transporter_protein-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.726
 

Sequence

CDS
ATGGACGGTACGAAACGGAAATCGGTAACTATTTCTGAAAAAATAGAAGATACACCGAAACAAGATGAAGATAAACTGATTCAAGCGATAGGTGAATTCGGGAGATGGCACGTGATGCTAACTATGACGCTATCTGCACCGATTCGAATGACGGCAGTCTGGAACCATTTGGGAATCATATTTCTGGCACCGAAAACTGAATTTATTTGCGCGGAGAGACGTAATAACAACGAAACCATCCAAGAATCGGAGTGCTACAGTGATTGTACTGAATACGAATACAAAACGGATTTCGTGAATACAATCATTTCTGAATGGGACCTAGTTTGCGATCGATCCTGGCTGACAAACTTCAACCAGACAGCTTGCATGTCCGGTGTTTTATTGGGCAGTATAGTTTTTGGATTTTTCGCTGATAGATTCGGTCGTCGTCCCGCTCTCCTGACGGCCTGCACCACGCAACTGATAGCTGGATTCACAGCGCCATTTTGCCCAAATTACATCACATTCACCTTGGTCCGATTCTTCAACGGCGCAGCTGTTGCTGGCGCATTACTGACTTCTTTTATTCTAATGATTGAAACCACGGGCATATCGAAAAGGGAACTAATGAACTGTATCGTTTCCGTGCCTCTGTCGGTGGGAGAAATGATAATGCCAATGTTTTCATATTACTTGAGGTCTTGGACTAGATATAGTTTTGGTCTCGCCCTGCCAAATTTGGTATTTTTGGTTTTATTCTTCATCGTACCAGAGTCTCCGAAGTGGTTGATTTCCGTTGGAAGGCTCGAGGAGGCGAGTTTGATTATGACGAAAATAGCGAAATGGAATAGACTTCCAACAGAAGACATGATGGATAGAGTAAAGATTATAGCATTTGAATCCAATGTTGACGCCCACAAAAACGTCAAGGCTACTTACTTAGACCTGATCAAAGTGCAGGAGATAAGGTGGAAGAATATCGGATGCTGTCTTACGTGGTTTATCCTCGGGCTGAGCTTCTATGGCAGCAATCAGTACATAGGACAGACCAGCCCTAATGTTTTCGTTGCTATTGCAATGGCTGGAGCTATTCAGACTACCTTTGACCCATTCCTTGTTCTATTACTGACCATAGAGACCGACTTAGCTGGAGGTCTTGAGGCTAATGAACTGATCATAATCGGCCACACGTTAACAGCCAAAAAGTAG
Protein
MDGTKRKSVTISEKIEDTPKQDEDKLIQAIGEFGRWHVMLTMTLSAPIRMTAVWNHLGIIFLAPKTEFICAERRNNNETIQESECYSDCTEYEYKTDFVNTIISEWDLVCDRSWLTNFNQTACMSGVLLGSIVFGFFADRFGRRPALLTACTTQLIAGFTAPFCPNYITFTLVRFFNGAAVAGALLTSFILMIETTGISKRELMNCIVSVPLSVGEMIMPMFSYYLRSWTRYSFGLALPNLVFLVLFFIVPESPKWLISVGRLEEASLIMTKIAKWNRLPTEDMMDRVKIIAFESNVDAHKNVKATYLDLIKVQEIRWKNIGCCLTWFILGLSFYGSNQYIGQTSPNVFVAIAMAGAIQTTFDPFLVLLLTIETDLAGGLEANELIIIGHTLTAKK

Summary

EMBL
BABH01044534    BABH01044535    BABH01034412    BABH01034413    ODYU01003353    SOQ42005.1    + More
KZ150304    PZC71520.1    JTDY01000054    KOB79138.1    NWSH01000158    PCG78950.1    KQ460367    KPJ15486.1    NWSH01003717    PCG65892.1    KZ149948    PZC76718.1    AGBW02009713    OWR50049.1    ODYU01002452    SOQ39959.1    AK402884    BAM19447.1    KQ459600    KPI94138.1    BABH01019600    NWSH01000020    PCG80713.1    KQ461195    KPJ06789.1    PCG80714.1    KQ459589    KPI97639.1    CVRI01000052    CRK99712.1    AJWK01002434    AJWK01002435    AJWK01002436    PCG80708.1    ODYU01006026    SOQ47506.1    GFDL01008134    JAV26911.1    GALX01001195    JAB67271.1    KQ971342    EFA04007.2    DS232350    EDS40471.1    GEZM01088532    JAV58130.1    GEZM01088533    JAV58129.1    CH477305    EAT44124.1    EFA04006.1    GAPW01001011    JAC12587.1    JXUM01109993    KQ565372    KXJ71040.1    KQ414775    KOC61282.1    BABH01019597    KQ434827    KZC07658.1    KZ150301    PZC71534.1    KZ288189    PBC34564.1    AAZX01006832    AXCN02000238    ODYU01004551    SOQ44555.1    KQ435759    KOX75743.1    AAAB01008859    EAA07935.5    APCN01000614    KQ971381    EEZ97586.2    GGFL01004566    MBW68744.1    GGFL01004591    MBW68769.1    KQ762190    OAD56165.1    CH954179    EDV55264.1    NEVH01005889    PNF38331.1    CH480816    EDW48649.1    KQ461198    KPJ05943.1    KB632314    ERL92208.1    KQ435794    KOX73779.1    APGK01048466    KB741110    ENN73834.1    AXCM01003853    AE013599    AY058478    BT120184    AAF57511.1    AAL13707.1    ADB91432.1    CM000158    EDW91444.1    KRJ99843.1    CM000362    CM002911    EDX07862.1    KMY95206.1    GL448504    EFN84558.1    NNAY01000983    OXU25618.1    NWSH01003004    PCG67121.1    AGBW02008774    OWR52572.1    KZ150029    PZC74769.1    KQ980581    KYN15387.1    KQ459185    KPJ03336.1    CH902619    EDV36845.1    CH963850    EDW74843.1    CP012524    ALC42779.1    AAZX01002446    ATLV01018145    KE525215    KFB42743.1    KQ760085    OAD61975.1    GL435766    EFN72668.1    GECZ01031285    JAS38484.1    KK107372    EZA51773.1    ADTU01022726    KQ976745    KYM75454.1    CH916375    EDV98284.1    KOB79137.1    KQ981673    KYN38256.1    NNAY01003667    OXU19035.1    GL435531    EFN73254.1    GAMC01009685    JAB96870.1    KQ976914    KYN07128.1    KZ288225    PBC31939.1   
Pfam
PF00083   Sugar_tr        + More
PF00400   WD40
PF12341   Mcl1_mid
PF12894   ANAPC4_WD40
PF08969   USP8_dimer
PF07690   MFS_1
PF03022   MRJP
Interpro
IPR020846   MFS_dom        + More
IPR036259   MFS_trans_sf       
IPR005828   MFS_sugar_transport-like       
IPR005829   Sugar_transporter_CS       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR022100   Mcl1_mid       
IPR017986   WD40_repeat_dom       
IPR019775   WD40_repeat_CS       
IPR001680   WD40_repeat       
IPR036322   WD40_repeat_dom_sf       
IPR024977   Apc4_WD40_dom       
IPR011041   Quinoprot_gluc/sorb_DH       
IPR015063   USP8_dimer       
IPR011701   MFS       
IPR017996   Royal_jelly/protein_yellow       
IPR011042   6-blade_b-propeller_TolB-like       
SUPFAM
SSF103473   SSF103473        + More
SSF50978   SSF50978       
SSF50952   SSF50952       
Gene 3D
PDB
4QIQ     E-value=1.79811e-09,     Score=150

Ontologies

Topology

Length:
396
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
128.83242
Exp number, first 60 AAs:
2.34326
Total prob of N-in:
0.87841
inside
1  -  113
TMhelix
114  -  136
outside
137  -  145
TMhelix
146  -  168
inside
169  -  174
TMhelix
175  -  197
outside
198  -  227
TMhelix
228  -  250
inside
251  -  320
TMhelix
321  -  343
outside
344  -  347
TMhelix
348  -  370
inside
371  -  396
 
 

Population Genetic Test Statistics

Pi
232.376667
Theta
41.211669
Tajima's D
-1.549115
CLR
130.75318
CSRT
0.056247187640618
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号