SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04184
Pre Gene Modal
BGIBMGA008660
Annotation
PREDICTED:_ubiquitin_carboxyl-terminal_hydrolase_8_isoform_X3_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 3.213
 

Sequence

CDS
ATGACGGAAACACGCCGTAAACAATTGCACCTCGGGAAATGCATCGAAGATCTGGACAAATTACACAATGTTCCAGATTTGAAAACGAAACGAGCTAACCTGTTATGCAAGACAGCACAGAAATTGTTTGAAAGCGCCGAAGAAGCTCGGAAAAATGGTGACGAGGAGTACTCCTACGTATATTACATGAAATATTTGAGAGTCATAGCCTATCTGAGCAAAGATAAGGAGTATCTGAAGGATAAGTCATACTACAACAGCATGCTGGGAGCTAAGAACCCTAACAAGGCTATTGATGCTGCTGAGAAACTAAAGAACAGTCTTATAGACAGGTATGCAATGGAATTGAAGCAGAAACGTCTAAATGACATAAAAGAGAATGAGATATTCAAACAAAAGATTGAGGAGAACAGAAAGAAGGCCATTGAGGTCTCCATCAATGAGCCGCCTTCGACACCTGTCAACTTACCAGGTCCTGATGAGGTGACCATCAAAAGCGAACAACTCTATTCAATCTTGAAGGCCGGCAAGTTGAAGGTCATGATCCTTGATGCAAGACCTGGGAAAGATTACTTAGAATCTCACATCAGCTACCCGGCTTGTATCAGTGTGCCCGAAGAATGCATATCACCTGGTCAATCAGCTAATGTCCTAGAACAGAATTTACCGGCAGCCTCCAGACCTGTCTGGAGTTCCCGGGCCTCGGCCGACCTCATCGTGACTTTGGACTGGAGCTCCAGGGCCCCTATACCGGGGACGCCGCTCCACTTGCTCAGGACCATACTGCTCAAGTGGGACATTAAAGTTCAGTACGCGAGACCGCCGCTCGCCCTCGAAGGCGGCTACGAGGACTGGCTGCTCAAGTACCCCGCGTCCACCACCAACCCGCAGGCGCAGCCGCCGCGCCCAGACGACTCCATGGACGACATGCTGGGAGACATAGAGTACCCGAGCTGGGCGGAGCTGAGTCCGCCCGCCGCACCCCGCCGCGCGCCCGAGCCCGACCGCGCCACCAAGGCCGCCGCCGTGCTGGTGTACGACGAGCGCGCCCGCACCATGCAGAAGATCCTCGAGCAGCAGGAGGTCATCGCCGACACCTCGCTCACCCTCGAGATGCAGAGGATCGAAGCTGAGCAGGACTGGGAGAAAGTTCGTTCGCAGCAGGAGACGGAACAACAAGACGACGTCAGAGCCATGTACCAGCTCAGGGAGCAGGAGATCATCAGTCAGCTCATGCAGCTGGAGAACAAGCAGTACGACATGGAACAAGAGAACCAGAGTCTCCGCGAGCAGCTAGAGGAGTACCAGCGTCGGGAGCGGGACGAGGCCGCCCAGCTAGCCGAGACCATCGCCAGCCAGGAGACCGAGGCCGACGCCGACGAGCGGGCCCGTGCGCGCACAGAGCTGGCCGCGCGCATCGCCGCCGTGCGCCAGCAGCGGGCGCGCCTGGACCGCACGCGCGAGCAACTCGAGCAGCAACGGAAGCGGAAGCTGGCGGAGGCCAGGGAGAAGAAGAAGCCCGGGGAGGACAGGGAGGATGACGGCGACGCATACATGGACGACAGCCCCGGGGCCGCCGCCCTCTCCCGCGCGCACTCCTCCCCAAACATCGCCAAGATGGAGGAGGAGGCTAGCGCCCCCCAGTTCGACCGCAGCACCAAGCCCGCGGCGCCCCCGCCCGCCGACCACGCGCACAGGGATTTCCAGCCGGTCTGGGGGACTGTGGGTCGTGGGTTGACCGGCCTGAAGAACCTTGGGAACACTTGCTACATGAACTCCATTATACAATGTCTGAACAACACCGCCATACTTGTCGCTTACTTCAGGAACGGGCAGTATCTGGAGCACGTTAACAGGTCGGCGAGCACCCGCGGCGCCATAGCAGAGGAAGTGGCGGCCGTGGTCAGGGCGCTGTGGTCGGGCCAGTACAGGTTCATCGCTACCAGAGATCTCAGGAACGAGGTCGGCAAGCAGCAGCGCGCCTTCCGGGGCTGCGAGCAGCAGGACTCGCACGAGTTCCTCACCATCCTCATGGACTGGCTGCACCTCGACCTGCAGTTCCGGGCCGACGCCCCCCCGCACAAGGACAGCCTCGCGCCCTCGGAGAAGGCTTGGTACGAGTACACCAAGTCTAAGGAGAGCCTCATTCTGCGGCTGTTCTACGGCCAGATCAAGTCGACGGTCCGGTGCACCGTCTGCTCCAAGCAGAGCGTCACCTACGAGTCCTTCTCCAACCTGTCGCTGGAGCTGCCGGCCAACGCCAACAGGTGCTCCTTAAGCGACTGCCTCAAGCTGTACCTGAGCGGCGAGACCATCCCGGGCTGGAACTGCCCCAACTGCAAGGACAAGCGCGACGCCGTCAAGAAGCTCGACATCTCCAAGCTGCCGCCCGTGCTGGTCATCCACTTCAAGAGGTTCTACGTGGACCCCAAGGAGTACCAGGCGAACGCGTACAGGAAGAAGCAGACCTACATCGACTTCCCGCTGGAGGGGCTGGACATGCGGCAGGTCGCCCCGGCCTGCCCCGGCGCCGCCGCCTACGAGCTGTACGCCGTGTCCAACCACTACGGCTCCATGGAAGGCGGCCACTACACCGCCTACTGCAAGAGCAGCCTCTACGGGAAGTGGTACAAGTACGACGACCACGTGGTCACCGAGATCCCCGCCAGCGACGTCAAGTCCAGCGCCGCCTACATCCTGTTCTACTCGTCCTGCGGGCCCGCGCGCGCCTCGTGA
Protein
MTETRRKQLHLGKCIEDLDKLHNVPDLKTKRANLLCKTAQKLFESAEEARKNGDEEYSYVYYMKYLRVIAYLSKDKEYLKDKSYYNSMLGAKNPNKAIDAAEKLKNSLIDRYAMELKQKRLNDIKENEIFKQKIEENRKKAIEVSINEPPSTPVNLPGPDEVTIKSEQLYSILKAGKLKVMILDARPGKDYLESHISYPACISVPEECISPGQSANVLEQNLPAASRPVWSSRASADLIVTLDWSSRAPIPGTPLHLLRTILLKWDIKVQYARPPLALEGGYEDWLLKYPASTTNPQAQPPRPDDSMDDMLGDIEYPSWAELSPPAAPRRAPEPDRATKAAAVLVYDERARTMQKILEQQEVIADTSLTLEMQRIEAEQDWEKVRSQQETEQQDDVRAMYQLREQEIISQLMQLENKQYDMEQENQSLREQLEEYQRRERDEAAQLAETIASQETEADADERARARTELAARIAAVRQQRARLDRTREQLEQQRKRKLAEAREKKKPGEDREDDGDAYMDDSPGAAALSRAHSSPNIAKMEEEASAPQFDRSTKPAAPPPADHAHRDFQPVWGTVGRGLTGLKNLGNTCYMNSIIQCLNNTAILVAYFRNGQYLEHVNRSASTRGAIAEEVAAVVRALWSGQYRFIATRDLRNEVGKQQRAFRGCEQQDSHEFLTILMDWLHLDLQFRADAPPHKDSLAPSEKAWYEYTKSKESLILRLFYGQIKSTVRCTVCSKQSVTYESFSNLSLELPANANRCSLSDCLKLYLSGETIPGWNCPNCKDKRDAVKKLDISKLPPVLVIHFKRFYVDPKEYQANAYRKKQTYIDFPLEGLDMRQVAPACPGAAAYELYAVSNHYGSMEGGHYTAYCKSSLYGKWYKYDDHVVTEIPASDVKSSAAYILFYSSCGPARAS

Summary

Similarity
Belongs to the peptidase C19 family.
Pfam
PF08969   USP8_dimer        + More
PF00443   UCH
PF00581   Rhodanese
Interpro
IPR018200   USP_CS        + More
IPR038765   Papain-like_cys_pep_sf       
IPR001394   Peptidase_C19_UCH       
IPR015063   USP8_dimer       
IPR028889   USP_dom       
IPR036873   Rhodanese-like_dom_sf       
IPR001763   Rhodanese-like_dom       
SUPFAM
SSF52821   SSF52821        + More
SSF54001   SSF54001       
Gene 3D
PDB
3N3K     E-value=2.96279e-79,     Score=755

Ontologies

Topology

Length:
911
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00885999999999998
Exp number, first 60 AAs:
0.00064
Total prob of N-in:
0.00030
outside
1  -  911
 
 

Population Genetic Test Statistics

Pi
213.727899
Theta
161.161281
Tajima's D
1.04267
CLR
0.006752
CSRT
0.668766561671916
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号