SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04166
Annotation
PREDICTED:_uncharacterized_protein_LOC105842971_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 3.348
 

Sequence

CDS
ATGCCGCGTGTTTATAAACCTGATCCTAGAGGGAAAAGATATAGAAAGTACGATGAAAATATTATAAATGAAGCTGTTGCCGCATATGCGAATGGCAAATTCTCTTTAAAGGCCATAGCAGAGAAATATGATATTGATAAATCTGTACTTTATAGACACAGTGTCAAAACTATGAAAAAACAAGGAGGGCAAACTATTTTAACTAACGAGACTGAAGAATGCATGATAAAGTATATCAATATATGTGCAGAATGGGGATGCCCTTTAGATGCTTTAGATTTGAGATACATTGTTAAGACTTATCTTGACCAAGTGGGTCGGACAGTACTCAAATTTAAAAATAATTTACCAGGCCCCGACTTTGTCGCGAGTTTTCTAAAACGTCACAAAAACCAAATTTCCCAAAGATATAGCCAAAACATTAAGAAAAAAAGGGCAGAAGTTTCACCAAACTTGATTAAAGAATATTTCAAAGAGTTAGAAGTGTCATTGGCAGGTATTAATCCGAGTTCTATAATTAATTACGATGAAACTAATTTGACTGATGACCCAGGACGCAAAAAAATCATTACTAAACGAGGAACGAAGTACCCAGAGAGGGTAATGAATAGTTCAAAGTCTTCAGTTTCATTGATGATAGCCGCTACAGCTGACGGCACTTTACTCCCGCCGTATGTGGTATACAAGGCTCAAAACTTGTATAACACATGGACTGAAAATGGACCACCAGGAGCAAGGTATAATCGTACGCAATCCGGTTGGTTTGATGCAACCATTTTTGAAGATTGGATTAAATCCATCATTATACCTCACTTCAAAGATAAAGTTGGGAAAAAGTGCCTAATAGGCGATAATCTCTCGTCGCATTTATCGATTGAGACAATAAAACTGTGCCACGAACAAAATATATCGTTCATTTTTTTACCGGCAAATAGTACACACCTCACACAACCTCTTGATGTAGCATTCTTCAGGCCTATGAAGATAGCATGGCGAAACGTAGTATTGAAGTGGAAAAAAACCGATGGGAAAGCCCAATCAACGATTCCAAAGGGATGTTTTCCTAGACTTTTAAATAAATTAATGGAAGAGCTTCGTAACAACAGTAAGGCTAATATAATAGCAGGATTCCGGAAAACAGGAATATACCCGATTAATGAAGAAGAGGTTTTAAGCAGACTACCTGAAGTTCAAAACAATGAAAAGAAAACTGAAATAGAAAAATCCGTTCTAGATTTGCTCAGGGAGATGAGATATGGAACCATGAACATAACCGAACCAAAAAGGAAAAAAAAGTTGATAGTAATACCTGGACGAAGCGTTGGTTCTGAAAGTGAAGACTACATAGAAACAGAACAAGAAGAAAGCCAACAAAAACCAAAAAAGGCAGATCTGAGATCCAAAATAACACAAAACAAAGAAAATACTACAACTAATACTTACGATGGCAAAGAAAACAATAAATATAAGGGAAAAGGTGTAGGGAAAAAACTAAAACACAAGATCAGAATATTGCTGAAAAAGAAAATAAACAAGAAAACGGACCAGACACTGAAAAAATACTACTTGACGCAATAA
Protein
MPRVYKPDPRGKRYRKYDENIINEAVAAYANGKFSLKAIAEKYDIDKSVLYRHSVKTMKKQGGQTILTNETEECMIKYINICAEWGCPLDALDLRYIVKTYLDQVGRTVLKFKNNLPGPDFVASFLKRHKNQISQRYSQNIKKKRAEVSPNLIKEYFKELEVSLAGINPSSIINYDETNLTDDPGRKKIITKRGTKYPERVMNSSKSSVSLMIAATADGTLLPPYVVYKAQNLYNTWTENGPPGARYNRTQSGWFDATIFEDWIKSIIIPHFKDKVGKKCLIGDNLSSHLSIETIKLCHEQNISFIFLPANSTHLTQPLDVAFFRPMKIAWRNVVLKWKKTDGKAQSTIPKGCFPRLLNKLMEELRNNSKANIIAGFRKTGIYPINEEEVLSRLPEVQNNEKKTEIEKSVLDLLREMRYGTMNITEPKRKKKLIVIPGRSVGSESEDYIETEQEESQQKPKKADLRSKITQNKENTTTNTYDGKENNKYKGKGVGKKLKHKIRILLKKKINKKTDQTLKKYYLTQ

Summary

EMBL
BABH01024482    GGMR01005791    MBY18410.1    ABLF02024787    ABLF02036293    ABLF02036295    + More
ABLF02036300    ABLF02036303    ABLF02036307    ABLF02020969    ABLF02020971    ABLF02006951    GECZ01009826    JAS59943.1    GEDC01023010    JAS14288.1    ABLF02018386    ABLF02041722    ABLF02062703    ABLF02021095    ABLF02021103    ABLF02021105    GEBQ01027923    JAT12054.1    ABLF02004276    ABLF02004277    ABLF02019754    ABLF02043119    DS232767    EDS45530.1    ABLF02031950    UFQS01000373    UFQT01000373    SSX03288.1    SSX23654.1    ABLF02003004    ABLF02053093    ABLF02064790    ABLF02014120    ABLF02031335    GEBQ01022752    JAT17225.1    ABLF02034490    GGMS01015966    MBY85169.1    ABLF02024890    PYGN01000900    PYGN01000153    PSN39546.1    PSN52644.1    ABLF02010048    ABLF02042417    GDQN01000733    JAT90321.1    PYGN01000316    PSN48625.1    KZ149957    PZC76450.1    ABLF02035413    ABLF02012638    RSAL01000111    RVE47096.1    GFXV01002448    MBW14253.1    AJWK01020237    AJWK01020238    ABLF02005267    ABLF02005269    ABLF02032408    ABLF02032409    ABLF02032413    GEZM01096654    GEZM01096605    JAV54775.1    NWSH01008222    PCG62646.1    GEZM01069098    JAV66644.1    ABLF02010036    ABLF02067222    ABLF02002783    ABLF02012639    ABLF02034252    ABLF02010037    ABLF02010039    ABLF02066755    ABLF02034492    ABLF02013132    ABLF02013134    ABLF02013135    ABLF02005217    GECU01010063    JAS97643.1    DS985244    EDV26187.1    GEHC01001021    JAV46624.1    ODYU01000374    SOQ35049.1    JTDY01007086    KOB65467.1    LBMM01008491    KMQ88832.1    AJVK01063592    GG666613    EEN48676.1   
Pfam
PF03184   DDE_1        + More
PF05225   HTH_psq
PF13843   DDE_Tnp_1_7
PF05380   Peptidase_A17
PF04937   DUF659
PF07530   PRE_C2HC
PF05699   Dimer_Tnp_hAT
PF00078   RVT_1
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF03221   HTH_Tnp_Tc5
PF04500   FLYWCH
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR029526   PGBD       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR011335   Restrct_endonuc-II-like       
IPR011604   Exonuc_phg/RecB_C       
IPR008042   Retrotrans_Pao       
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR007021   DUF659       
IPR008906   HATC_C_dom       
IPR006579   Pre_C2HC_dom       
IPR000477   RT_dom       
IPR027124   Swc5/CFDP2       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR007588   Znf_FLYWCH       
SUPFAM
SSF46689   SSF46689        + More
SSF53098   SSF53098       
SSF52980   SSF52980       
SSF56219   SSF56219       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
525
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05841
Exp number, first 60 AAs:
0.01874
Total prob of N-in:
0.00575
outside
1  -  525
 
 

Population Genetic Test Statistics

Pi
195.353978
Theta
180.262279
Tajima's D
0.287348
CLR
0.315766
CSRT
0.444477776111194
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号