SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04142
Annotation
PREDICTED:_uncharacterized_protein_LOC106716864_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.508
 

Sequence

CDS
ATGACGGAGTTCACTAAATTATTTGAAGCTTCACTAGGATCAGTTGCCCCTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCTGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCAAGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTACTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTAGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGACGCCACCGGACTCGGCGTGGCCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGTAG
Protein
MTEFTKLFEASLGSVAPHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVASTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRITGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVAWVRCPVASAKKIALSGRLL

Summary

Pfam
PF00098   zf-CCHC
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756       

Ontologies

Topology

Length:
312
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00077
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.01110
outside
1  -  312
 
 

Population Genetic Test Statistics

Pi
244.031084
Theta
170.568315
Tajima's D
2.321633
CLR
0.005981
CSRT
0.926453677316134
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号