SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04138
Pre Gene Modal
BGIBMGA008686
Annotation
PREDICTED:_neural_cell_adhesion_molecule_2-like_isoform_X2_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.42
 

Sequence

CDS
ATGCCTTACTTGAAAAAAGCAGATTTAACTTCAGCTGCAGTTGATTTTGTTCCAGTATCCACGATGGGTGTGGAGGCTGTGGTGGGGCGCACCGCCTCCCTGCCCTGTGACATCGAGCCCGACTCGAACGAGGATAGAGTCTACATGGTGCTGTGGTTCAGACACGCCGGTGGAAAACCTTTGTACAGCTTCGACGTTCGCGGCAGGAGTTTCAACAAGGCCCTGCACTGGTCAGACCCTACCGCCTTCGGGAGGAGGGCGTACTTCGTGACCATGTCCCGACCCTCGGCTCTGACTGTTGACGGCGTGCAGTTAGACGACGAAGGGGTATACCGCTGCAGAGTCGACTTCAAGAATTCGCCAACGAGAAACTTCCAGATCAAATTGAACGTCGTCGTTCCACCGCATCAGCTCCTTCTGTACGACGAAGCTGGTCATGACGTGGCGGGAGTTGTTGGGCCATTAGAAGAGGGGGGCAACTTTACATTGCTATGCGAGTTGAGAGGAGGTCGACCTCAACCAACCTTAACGTGGTTGATCAACAACAAGCCTATAGAAGACCACACGGTCCTCAAGAACGACGGCAAGGTCATCGTGAGCCGGATCAGCATAGGAGGAGCCGAGAGGAATTGGTTGAACACCAGCATACGATGCCAGGCCACCAACACTCCGCTGCTAAGTCCTCACGAAAGGACCGCCAGGGTTGAAATGCATCTGCGTCCACTTTCGGTCCTGATCAGTAACAAACCAGGACAAATGTCGGCCGATATGGAAATGACTCTTGTGTGCGTCTCGCACGGCAGTAGACCGCCAGCTCAGATAACGTGGTTCAGAGAAAACAGAAGATACACAAGGGGAAAGCACAGCGAGTTCACCAATGAGACCACGACAGTGAGCCGGCTGACGATGCTTCCCCAACCAGAAGACGACGGCGCCATCATCAGATGCAGAGCCGACAATCCCGTGCTGAGGGTCGCCCTGGAAGACTCATTCATGATGAGCGTTGTCTACCGACCGGTATTGACAATGGCATTAGGCAGCACATTGAACCCGAACGACATCAAAGAAGGCGACGACGTATACTTCGAGTGCAACATCAAGGCGAATCCAAAGGAACACCGCATCACTTGGTATCACAACGATGAGCCGGTCCTCCAGAATATATCGTCAGGAGTCTTCATCAGCACCAAGTCCTTAGTTCTGCAGCGGGTGACGAAGGTGGATGGAGGTCTGTACACGTGTCGAGCTGCTAATCAGATGGGAGAATCTCACAGTCGGGCCGTTTACCTTAGAGTTCAATATGCTCCGACTTGCGCCCAACCTTCTCCCCTGGTGGTCGGCGCGCGACTGGACGAGCCTCTCCGCGTGCGGTGCACCGTCAGCGCCGACCCCGCCGACGTCTCCTTCTACTGGCAGTTCAACAACAGCGGCGAGAGTTTCCAAGTCTCCCCCGCTAGATACGTGTCCACGGGCGGCACCACCAGTGAGCTCCGGTACCGGGCGGCCAGCGAACGGGACTACGGGGCCCTGCTGTGCCGCGCCACCAACTCGGTCGGCAGACAGAAGCGGCCGTGCGTCTTCCAGATTGTTCCGGCAGCAAGACCTTCTCCGCCGAGAAACTGTACAACGAATAGAGTTCTAAAGAACAATTTAGCGTATCTTGCTGTGAAATGCGTCGCTGGCTACGACGGGGGATTGACCCAGCACTTCACCCTCGACGCTGTGGGAGAAATCACCAGAGTCCTGGTCAATGCTTCAGCCGGATCAAGTGATTTAATAGTGCATCTAAACGTAAGCTGGTCAACCCTGGAGTCTTTGTCGGAAGATGAGGAACTTGTGGTGACAGCACGGAACAGCAAAGGGGCTTCGGATCCCGTTCCCTTGAGAGAAGTGGTCTTCAGAGATGCTGCAAAAAGAGCAGAAAGCACGACAAGAGCGGAGAGCAAGTTTCCCCTGGCTGCAACTTTAGCTGCTCTAGCGGCGATCCTCACTGCAGTGTCCGCTGTGGTCATTGTGCTTTTGCGCAAGCGCAACGACAACTCCTCGAACAGTAAACGACCATCGCAGAGCGTGGTGCAGGTAGACGCTGAGGGCAGACGCTACCTCATAGCCTACCCTCCCGCTGACAAACCAGAGTCCAAGCCGGATATCCTCAATCCAAAATCTGACAACGAACCCCCACGCGTGGTGTTGGAGTCATGCGACAGTAAGAACTACGTCATCAGGGAGGTCAATAGTGACCACCGACCTGCGGCATACAACTCTCACACGCCTGACGAAGGATTGATGCCGCAGAGATAA
Protein
MPYLKKADLTSAAVDFVPVSTMGVEAVVGRTASLPCDIEPDSNEDRVYMVLWFRHAGGKPLYSFDVRGRSFNKALHWSDPTAFGRRAYFVTMSRPSALTVDGVQLDDEGVYRCRVDFKNSPTRNFQIKLNVVVPPHQLLLYDEAGHDVAGVVGPLEEGGNFTLLCELRGGRPQPTLTWLINNKPIEDHTVLKNDGKVIVSRISIGGAERNWLNTSIRCQATNTPLLSPHERTARVEMHLRPLSVLISNKPGQMSADMEMTLVCVSHGSRPPAQITWFRENRRYTRGKHSEFTNETTTVSRLTMLPQPEDDGAIIRCRADNPVLRVALEDSFMMSVVYRPVLTMALGSTLNPNDIKEGDDVYFECNIKANPKEHRITWYHNDEPVLQNISSGVFISTKSLVLQRVTKVDGGLYTCRAANQMGESHSRAVYLRVQYAPTCAQPSPLVVGARLDEPLRVRCTVSADPADVSFYWQFNNSGESFQVSPARYVSTGGTTSELRYRAASERDYGALLCRATNSVGRQKRPCVFQIVPAARPSPPRNCTTNRVLKNNLAYLAVKCVAGYDGGLTQHFTLDAVGEITRVLVNASAGSSDLIVHLNVSWSTLESLSEDEELVVTARNSKGASDPVPLREVVFRDAAKRAESTTRAESKFPLAATLAALAAILTAVSAVVIVLLRKRNDNSSNSKRPSQSVVQVDAEGRRYLIAYPPADKPESKPDILNPKSDNEPPRVVLESCDSKNYVIREVNSDHRPAAYNSHTPDEGLMPQR

Summary

EMBL
RSAL01000082    RVE48510.1    AGBW02009972    OWR49444.1    NWSH01000305    PCG77591.1    + More
KZ150231    PZC71994.1    RSAL01000001    RVE55340.1    KQ460045    KPJ18124.1    KPJ18125.1    AGBW02008103    OWR54162.1    KZ149994    PZC75507.1    KQ459604    KPI92377.1    ODYU01000599    SOQ35673.1    ACPB03001712    GL449385    EFN82816.1    KQ978205    KYM96491.1    GL888128    EGI66806.1    KQ978957    KYN26989.1    QOIP01000012    RLU15688.1    KQ981897    KYN33674.1    KQ976488    KYM83604.1    KQ982320    KYQ57806.1    KK107185    EZA55761.1    AE014297    ABI31143.1    KZ288194    PBC33881.1    GL440425    EFN65915.1    KQ434905    KZC11236.1    ADTU01025477    ADTU01025478    ADTU01025479    ADTU01025480    CH902617    EDV43748.2    KPU80440.1    CM000160    EDW97807.2    ABI31142.1    OUUW01000005    SPP80239.1    SPP80240.1    CM000070    EDY68097.2    APCN01002160    APCN01002161    NNAY01001084    OXU25200.1    CH933806    EDW14673.2    KRG01141.1    CH964272    EDW84633.2    CP012526    ALC46414.1    CH940656    KRF78339.1    CH916377    EDV90739.1    GAMC01018645    JAB87910.1    GAMC01018648    JAB87907.1    GBYB01013606    GBYB01013607    JAG83373.1    JAG83374.1    KQ414667    KOC64681.1    KQ435863    KOX70423.1    JTDY01000670    KOB76275.1    NWSH01001251    PCG71977.1    KQ971354    KYB26230.1    GBHO01002348    GDHC01008300    JAG41256.1    JAQ10329.1    GBRD01006221    JAG59600.1    BT071799    ACN43735.2    EFA06826.2    GEDC01028050    JAS09248.1    KK852551    KDR21492.1    CH480815    EDW42308.1    CH954181    EDV49222.1    AAF54952.3    AFH06404.1    ALC47181.1    CM000364    EDX13063.1    EDW97249.1    KRK03606.1    GECZ01013250    JAS56519.1    NWSH01001734    PCG70297.1    GEBQ01019020    JAT20957.1    NEVH01020344    PNF21422.1    KRT00496.1    GEZM01002471    JAV97235.1    EDV41691.1    KPU79296.1    KPU79297.1    KPU79299.1    EAL28149.2    KRT00494.1    KRT00495.1    KRT00497.1    CH479179    EDW24155.1    OUUW01000013    SPP87858.1    CH916369    EDV92962.1    ODYU01008707    SOQ52514.1    EDW84074.1    CH940652    KRF78738.1    JRES01001160    KNC24967.1    GAKP01006691    JAC52261.1   
Pfam
PF07686   V-set        + More
PF08205   C2-set_2
PF00047   ig
PF16012   DUF4780
PF07679   I-set
Interpro
IPR013106   Ig_V-set        + More
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013162   CD80_C2-set       
IPR013783   Ig-like_fold       
IPR013151   Immunoglobulin       
IPR031961   DUF4780       
IPR003961   FN3_dom       
IPR036116   FN3_sf       
IPR013098   Ig_I-set       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
Gene 3D
PDB
5ZO2     E-value=6.9508e-13,     Score=182

Ontologies

Topology

Length:
766
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.57584
Exp number, first 60 AAs:
0.01894
Total prob of N-in:
0.00117
outside
1  -  651
TMhelix
652  -  674
inside
675  -  766
 
 

Population Genetic Test Statistics

Pi
291.673126
Theta
170.816322
Tajima's D
1.37416
CLR
0.596211
CSRT
0.75671216439178
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号