SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04125
Pre Gene Modal
BGIBMGA010007
Annotation
putative_DNA_helicase_[Cotesia_vestalis_bracovirus]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 1.953 PlasmaMembrane   Reliability : 1.316
 

Sequence

CDS
ATGGGCAACATGGAAGAACAACTTGATCGACGCCTAGAGATCAATGCAGGAATGAAGCGAGCAATTCTTCAAGACTTGCAGTGTCTGCTTCATGAACATCATGCGTTGGTCAGGTTGTTTAAGAGTGCTTTAGAGCGCATGCCAAGTGATGACTATAAAGTTGTTATCAAAGCAGATAAACGACCATCTGGAACACACGAAGGGACATTTAATGCTCCAACAGTAGACGAACTTGCCATCCTGATTGTTGGTGAACAATTGGAAAAACGCGATATTGTGCTTACACGTCGCGATACTGGGCAACTGCAACAAATATCTGAAACTCATCGATCATATGACACATTGCAATACCCGCTGATGTTTTGGCAAGGAGAAGATGGATATTATTTTAATATTAAAATGAAAAATCCATTGAATGGTGAAGAAACTACAAAGAAAGTTAGCTCAATGAATTATTACGCATATCGTTTGATGATTCGTCAAAATGCTGACAACTATTTGCTGCGGTTTCGTCGATTGTTTCAGCAGTATTGCGTTGACATGTATGTAAAAATAGAAACGGAACGTTTAACATTCATTAGGTTGAACCAAGCCAAACTGCGTTCTGAGGAGTACATCCATTTACGTGATGCAGTTAGTACTGAAGGAAATGCAGCTAATATTGGTCGATTAACTATTCTGCCGGCGACATACATTGGTAGTCCACGTCATATGCATGAATATGCACAAGATGCAATGACATATGTTCGTCATTACGGTCGGCTTGATCTCTTTATTACTTTTACCTGTAATCCAAAATGGATAGAAATTACTCAATTGCTGCTTCCCGGACAAACATCAAGTGATAGACACGACATCACAGCACGTATATTCAGGCAAAAAATTCGGTCCCTGATGAACTTTATTGTTAAACAACGCGTCTTTGGAGACACTCGATGCTGGATGTATTCAATCGAATGGCAAAAGCGAGGCCTGCCGCACGCACACATTCTTATTTGGTTAGTGGAAAGAATTCAGCCTGACCAAATAGATGATATCATATGTGCTGAGATTCCTGATTATGAAGTCGATCCAGACCTACATGATGTTGTTACTACTAATATGATTCATGGACCGTGTGGTGCCATCAATCCCCAATCACCTTGCATGGTCGATGGAAAGTGCTCTAAACGATATCCACGGAAATTAACGGCGGAGACTGTCACTGGCAATGATGGTTATCCGCTGTATCGGCGTCGATCACCAGATGACAACGGTCGAACTGTCACAACGAAAGTGAAAAGAATGGATTTCGTTGTCGACAACAGTTGGATTGTTCCATATTCGCCACTTATTTCTAAATCGTTCAAGACACATTGCAACGTTGAATACTGCAATTCAGTTAAGTCCATAAAATATATTTGCAAATATGTCACGAAAGGCAGTGATATGGCGGTTTTTGGATTGCAATCCTCGAATACCAACGATGAAATTTCACGCTATCAAGTTGGTCGTTATGTGAACTGTAATGAAGCGATTTGGCGTATATTCGCATTTCCCATTCACGAACGTCATCCTACTGTTACGCATTTGGCGGTGCATCTGGAGAATGGTCAACGAGTATATTTCACGGCTTCGAATGCTACGCAACGTGCTGAAACACCTCCAGCAACTACATTGACCAGTTTTTTTTCAATCTGCCAAAGCGATCAGTTTGCACGAACTTTGCTTTACTCGGAGATGCCACGTTATTATACTTGGAATGCTTCATCGAAGAATTTTCAAAGACGGAAGCAAGGCGATGCGGTTCCTGGGTATCCAGATGTGCGTTCTACTGATGCTCTTGGTCGTATGTATACAGTTCATCCAAAGAATAATGAATGTTTCTATTTGCGGTTGTTGCTGGTAAATGTGCGTGGGCCAACGTCATTTGAGTCACTACGAACTGTTAATGGTGTAATATTCCCAACATATCGTGCTGCATGTGAAGAATTGAAGTTATTAGAAAACGATAGTCATTGGGATACGACAATCGCTGAAGCCATTATCTCTGCATCTCCAAGTCAGATACGCACATTATTCGCTATCATAATTTCGACATGTTTTCCACCAAACCCATGTAACCTGTGGCACAAATACAAGGATAATATGTCAGAAGATATTTTACATCAAATTCGTGTCAGTTCCAGAAATCACGATATTGAGATGAATGAGGAGATACATAATCGTGCTTTACTCTTGATCGAAGATATGTGTTACCTCATGTGCGGTAATTTATTAATCAGGTTAGGAATGCCAGCACCATATCGTGAAATGAATGACGCATTTAATCGAGAATTGGAAAGGGAACGTGAATATGATCACCAGGAATTAGATTTAGTAGTTCAAACGAATGTACCCCTGTTGAATTACCAACAAAAGGAAGTTTATGATACTTTAATGAAGGCAATCGATGATGAAAATGGTGGTTTATATTTCCTAGATGCCCCTGGTGGAACTGGCAAGACATTCCTCATGTCATTAGTTTTAGCAACTGTTCGGGCGAGATTTAACATAGCGGTTGCAGTTGCTTCTTCTGGAATAGCAGCCACATTGTTAGAAGGATGCCGTACGGCTCATTCAGCATTCAAATTACCGTTAAATCTTCAAACTATTGAAGAACCAACGTGTAATATTGCAAAACACTCAGCAATGGCCAAAGTTTTAGCGATATAA
Protein
MGNMEEQLDRRLEINAGMKRAILQDLQCLLHEHHALVRLFKSALERMPSDDYKVVIKADKRPSGTHEGTFNAPTVDELAILIVGEQLEKRDIVLTRRDTGQLQQISETHRSYDTLQYPLMFWQGEDGYYFNIKMKNPLNGEETTKKVSSMNYYAYRLMIRQNADNYLLRFRRLFQQYCVDMYVKIETERLTFIRLNQAKLRSEEYIHLRDAVSTEGNAANIGRLTILPATYIGSPRHMHEYAQDAMTYVRHYGRLDLFITFTCNPKWIEITQLLLPGQTSSDRHDITARIFRQKIRSLMNFIVKQRVFGDTRCWMYSIEWQKRGLPHAHILIWLVERIQPDQIDDIICAEIPDYEVDPDLHDVVTTNMIHGPCGAINPQSPCMVDGKCSKRYPRKLTAETVTGNDGYPLYRRRSPDDNGRTVTTKVKRMDFVVDNSWIVPYSPLISKSFKTHCNVEYCNSVKSIKYICKYVTKGSDMAVFGLQSSNTNDEISRYQVGRYVNCNEAIWRIFAFPIHERHPTVTHLAVHLENGQRVYFTASNATQRAETPPATTLTSFFSICQSDQFARTLLYSEMPRYYTWNASSKNFQRRKQGDAVPGYPDVRSTDALGRMYTVHPKNNECFYLRLLLVNVRGPTSFESLRTVNGVIFPTYRAACEELKLLENDSHWDTTIAEAIISASPSQIRTLFAIIISTCFPPNPCNLWHKYKDNMSEDILHQIRVSSRNHDIEMNEEIHNRALLLIEDMCYLMCGNLLIRLGMPAPYREMNDAFNRELEREREYDHQELDLVVQTNVPLLNYQQKEVYDTLMKAIDDENGGLYFLDAPGGTGKTFLMSLVLATVRARFNIAVAVASSGIAATLLEGCRTAHSAFKLPLNLQTIEEPTCNIAKHSAMAKVLAI

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
HQ009558    AEE09607.1    GAIX01013838    JAA78722.1    RSAL01000011    RVE53580.1    + More
GL444143    EFN61253.1    RSAL01001639    RVE40746.1    KE126587    EPB66060.1    JARK01000714    EYC35207.1    ABLF02021131    ABLF02042289    KN739487    KIH54222.1    KN743176    KIH52626.1    ABLF02017703    ABLF02041883    ABLF02039418    ABLF02041882    NIVC01000229    PAA87485.1    NIVC01000366    PAA84583.1    NIVC01000111    PAA90396.1    NIVC01001359    PAA68995.1    NIVC01001445    PAA67902.1    NIVC01001486    PAA67379.1    KN730521    KIH60924.1    ABLF02016067    ABLF02055484    RSAL01000338    RVE42429.1    NIVC01000900    PAA75136.1    RSAL01000340    RVE42412.1    ABLF02018127    JOJR01000041    RCN48933.1    JOJR01000111    RCN45090.1    ABLF02041819    ABLF02020814    ABLF02049665    KN761288    KIH48241.1    ODYU01007016    SOQ49380.1    NIVC01002773    PAA55312.1    KN767628    KIH47497.1    KN768033    KIH47189.1    NIVC01001383    PAA68602.1    NIVC01002034    PAA61410.1    LBMM01013912    KMQ85421.1    ODYU01007113    SOQ49602.1    NIVC01001722    PAA64736.1    NIVC01001945    PAA62370.1    NIVC01000381    PAA84309.1    NIVC01004666    PAA46875.1    NIVC01004230    PAA48122.1    BDIQ01000091    GBC29771.1    NIVC01000175    PAA88803.1    NIVC01001478    PAA67511.1    BEXD01001738    GBB95559.1    BDIQ01000188    GBC51003.1    BDIQ01000010    GBC12419.1    NIVC01000290    PAA86251.1    BDIQ01000117    GBC37632.1    OIVN01003845    SPD13901.1    OIVN01001558    SPC95338.1    OIVN01005182    SPD21271.1    OIVN01002335    SPD02687.1    OIVN01004665    SPD18618.1    KN818726    KIL54493.1    JEMT01027503    EXX56857.1    JEMT01028031    EXX55742.1    BEXD01003863    GBC03020.1    AACS02000012    EAU86521.2    KZ864805    RIA05079.1    ASHM01004598    PNY11526.1    LUEZ02000013    RDB28029.1    OIVN01003220    SPD09562.1    NIVC01004365    PAA47686.1    AB024034    BAB02793.1    KZ867928    RIA04228.1    LUEZ02000010    RDB29535.1   
Pfam
PF05970   PIF1        + More
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
PF08646   Rep_fac-A_C
Interpro
IPR027417   P-loop_NTPase        + More
IPR025476   Helitron_helicase-like       
IPR010285   DNA_helicase_pif1-like       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
IPR003840   DNA_helicase       
IPR003323   OTU_dom       
IPR012340   NA-bd_OB-fold       
IPR013955   Rep_factor-A_C       
SUPFAM
SSF52540   SSF52540        + More
SSF54001   SSF54001       
SSF50249   SSF50249       

Ontologies

Topology

Length:
897
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.98012
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00008
outside
1  -  897
 
 

Population Genetic Test Statistics

Pi
154.81963
Theta
4.899731
Tajima's D
1.187997
CLR
125.499681
CSRT
0.734613269336533
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号