SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04111
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.747 Nuclear   Reliability : 1.731
 

Sequence

CDS
ATGGACGCTGTATTTGCGGAATTTCTCCGGCTTCGCTACCCAAAACTCACTTCTGAGTTTCAGGCCTTCAAGGCCGATCACACCGCGAGCCCTCTCGTGGACTCCGCTGAGCTTGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTTTGTATCGAGCACCGCCGCCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTGGTCACCGTTGCGCCCTCCAAAACACCTACTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCCCCCGTCTCATCGACGGATGGATTCACACTGGTGCAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCTCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGAACGAGTTGCCCTGGCCCTTAAGGCCAAAAATATCAATTTTACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCACACGTATACGCTCCAGGAGGAGCGCGAACTCCGTGCCGTTATACGTGGCATCCCTAAAGAGTTGGATGCCGAGCTCGTCAAGGCCGACCTTCTCGAACAAGGCCTACCGGTTAACTCCGTACACCGCATGCACACAGGCCGCGGAAGGGAGCCATATAATATGGTTCTCGTCGCCCTCCAGCCTACCCCCGAGGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCTTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAAAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCACTCGCAGGCCCCTCAGGCCGACTCACGGCGTTCGATGATGACGAAAAAACAGAGCTGTTGGCCGATACATTGCAAACCCAGTGTACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGATATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATCAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTTACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATAACCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCAGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGACCCATCAGATCCAATAACCTTTGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGATTTCACCAAGACTACACTATAG
Protein
MDAVFAEFLRLRYPKLTSEFQAFKADHTASPLVDSAELAAPASPVPACKAFVSSTAASVVPAVPASPILASKTAASSAVVTVAPSKTPTRRSPAPASSSSDSDSEMEVDLAPVSSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWERVALALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLKGLAPSQRSYYRLARTLKSDTVVTMPPLAGPSGRLTAFDDDEKTELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADDIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFSQSITWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKQSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLDFTKTTL

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
956
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.81536
Exp number, first 60 AAs:
0.0009
Total prob of N-in:
0.00110
outside
1  -  956
 
 

Population Genetic Test Statistics

Pi
0.974992
Theta
0.336228
Tajima's D
2.256684
CLR
0.674405
CSRT
0.999950002499875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号