SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04110
Pre Gene Modal
BGIBMGA012989
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.648
 

Sequence

CDS
ATGGCGTCAACAGTTCCAGTAACAAACGCCATAAATTATTACCCACAACTTAACGTGGAAAATTACAATAGCTGGAAGTTTCGACTGAGATGTCTATTAGACGAAAAATCTTTGTTAGAGGTAGCGTCAAGTGGCGTTATAGAATTAAAACAAAAAACTGCTGATGCGGCTGCAAAAGCCTTAATAGTAAAATGTGTACCCGATAAGTACTTGGACATCATAAAAGATGCAACAACTAGCTACACAATGTTAGCCAGTCTGGATAAAGTTTTTGAGAGAAAAGGTATTTTCACTAAATTACACTTGCGAAGAAAGTTATTGTCTCTTAAGCTGAGGGATGATAAATTGGAAGACTATTTCATGAGATTTGAAAGTCTGATTAGAGAAATAGAAAATATTGATAAAAAGATGGATGAAGAAGATAAAATATGTTATTTGCTGACGGGTATGTCGGAAAAGTACAACACAGTGATAACTGCTATTGAAACAATGTCTGCAGATAAAATTGACATGGAGTTTGTCAAGGCTCGGTTATTGGACGAAGAACTCAAACTGAATAATAAAGGTGAAGAGTATAATGATACAAAGAATGATGTAAGTTTTACTGCCTCAAGTGTAGAATGTTATCGTTGCCACAAAAAGGGCCATTTTGCACGTGAATGTAGAAGCAGAGGTCGTGGCTATTCAAGGAGAAACATTAATAATAAAGGTATATGTGGTAAAAACAGAACTGAAGAACAAAATAATATGACAGAAAGCATCCCAGAGAATAAATATAATTTTCTAGCAATAACGGAGTGTAATCTAAGTAAAGAAGACAAATTTATAGAATTTATAATAGATTCAGGAGCTACAGAAAATCTTATCAAGGAAGAATTGGAGAAATACATGTATGAAATTAAGAAACTACCAAATAAAATAAAAATTAAGATTGCAAATGGAGAAATATTAGAGGCTGACAAGAAAGGAAAGATAACCATAAGAGATAAAAATAATAATACTATAAATATAGAAGCGTTAATGGTCCCAGGGATTTATCATAATATAATATCTGTAAGAAACTTAAATATGAAAGGAAATAAAGTTGTTTTTACAAAATTTGGAGCACAAATAATAAATGGAAGAAAAGTCTTAAAATGTTCAGATAGAAATGGTTTATATATAGTACAAGGCGAAATAATACTAATAGAAGAAGCGAACTCAAGTGTACAGCAAGACAAAAATATTTGGCACCAACGTCTCGGACACTTAAATAGGAAATCATTAAAAATTATGGGTTTACCTGTGTCTGATGAAACATGTGGTCCTTGCATGAAGGGAAAATCTACTCGTTTACCATTCTATCCAGTTGACAGGCCAAGAAGTAGAAAAATAGGAGAATTATTGCATACAGATATTGGAGGTCCTGTATCACCAATTTCTTATGATGAAAAACAATATTACCAGACCATAACTGATGATTTTTCTCATTTTGTGACTGTTTATCTATTAAAGAATAAATCTGAAGCCACAAGAAATTTAATAAATCATATAAAGGAGTTAGAAAGACAAAAGGAAACTAAAGTTAAACGCATAAGATGTGATAATGGTGGAGAGTTCACCGCTGGCTGTTTGAAGCAATTTTGTATGGAAAATGGAATTATAATAGAGTATAGTCAACCTTACACACCACAACAAAATGGTGTGGCAGAGAGGCTAAACAGAACATTACTAGATAAGTCAAGAACTTTATTAAGTGAAACTGGATTACCTAAATATTTGTGGTCTGAGGCTATAATGTGTGCAGCATATCAATTGAATCGATGCCCATCAAGATCTATAAAGTATAAGATACCAGCTGAAATATACTACGGACTAGAAAATGTTAACTTGAACAAGTTAAAGGTATTTGGTTCTAAAGCATGGTATACGTGTGTCCCACAGAATAAGAAATTAGATAATAGAGCTGAAGAAGCCATTATGGTTGGCTATGGCAAACAAGGTTATAGATTATGGAATCCAAAAACAACAGAAATAATATTCTGCAGAGATGTCAAGTTTGATGAAAAGTACTATGAACATAAAAACAGTATTAAAAATAACAACTATATTTATTTACCAGAAGAGGACACACAAAATGAAGTTATGTGCAATGATAAAAATAAAATTGAGGAAGAAAAAGTAATACAGAAAAATGAAGAGACAGACACAAAAAGAACTAGATCAGGAAGGATAATAAAGCAACCTGATTATCTAAAGAATTTTGGGACGTACACAGCATATTGTTACTTAGTGTGTAATGACCCAGAAAGCTATGAAGAAGCGATAAAAGAAGTTTCATGGAAAGAAGCGATACATAAGGAATTAGCAGCACTTGAGAACTTACAAAGCTGGGAAGAGACTAAACTACCGAAAGGAAAATTAGCTATAGACACTAAGTGGGTTTTTAGAACGAAAGACGATGGCACTAAGAAAGCCAGATTAGTCGCTCGAGGTTTTCAAATAAAAAATTATGAGAATGAAATATTCTACAGTCCTGTAGTAAGAATGTCTACGATAAGAGCATTTTTTGTAAAAGCTATCCAAGAAGGATACAAATTAAGGCAATTGGATATTCCTACAGCCTTTCTCAATGGATTTCTTGATAGTGAAGTTTATATAAAAATACCCAAAGGCAAAGAAAACAAAGATGGAATAGTTTTGAGGTTAAAGAGAGCATTGTATGGATTAAAAGAAAGCCCTAAATGCTGGAACATGAGATTTGATGAATTTGCAAGAAAGAATGGATTGATACAGTCATTACATGATTGTTGTCTATACACAGATAAAAATATATGGCTTATAATATTTGTAGATGATATTTTATTAATTGGAATGGAAAAGGATACAGAAAAAATTATTAATAAATTGAAGCAAGAATTTAAAGCTAAAGATTTAGGACAGATTGAGAAATATCTTGGTATGGAAATTAAACAGGAAGAAAGTAAATTAACGATTAAACAAGAAAAGATAATTGAGAAGATACTAGAAAAATTTGGAATGTCAGAATGTAAAGGTATAGGAACACCTATGGAGGTAAATTTTCAAATAAACAAAAATGAGAAGATTATTGATGTACCATATCGACAACTCATAGGAAGCATAATGTATTTGGCTACTATGTCCAGACCAGATCTGCAGTTTGCTGTATCATATCTTAGCAGATACTTAGACTGTCCTACTCAACAGACTTGGAAAGCTGGAAAGAGAATTCTGCAATACCTAAAAGCTACAAAAGACAAAATGTTAGTTTTTCAAAAAAGGAATAATCTAGATGTGGATTTATGTGCATATTCAGACTCTGATTGGGCAGGTGATATTGTTGATCGCAAAAGTGTCAGTGGGGGTATCATAATGTGTAGTGATAATCCTGTATTTTGGTACTCTAGAAAACAAAGTTGTGTTGCATTATCGACAGCAGAATCAGAGTACATTGCTAGTGCTTGTTGTGCTCAAGAGTTAGTGTATTTGAAAGGTGTACTGTGTGATTTTGGATATGAATGTAAATTGACTTTATTTATGGATAATAAGGGAGCAATATGTTTAGCGAAGTCAAATGAAAACTCTAAAAGGAGTAAGCATATTGATATAAGGATGCACTATATTAAGGACTTGGTGAGGAATAATGTATTAGATATTGAATATGTGTCATCTGATAAAAATATTGCTGATATTTGTACAAAATCTTTATGCAAAGAAAAGTTTGTATTTTTTAGAAGTTTGTTACTAAAGTAA
Protein
MASTVPVTNAINYYPQLNVENYNSWKFRLRCLLDEKSLLEVASSGVIELKQKTADAAAKALIVKCVPDKYLDIIKDATTSYTMLASLDKVFERKGIFTKLHLRRKLLSLKLRDDKLEDYFMRFESLIREIENIDKKMDEEDKICYLLTGMSEKYNTVITAIETMSADKIDMEFVKARLLDEELKLNNKGEEYNDTKNDVSFTASSVECYRCHKKGHFARECRSRGRGYSRRNINNKGICGKNRTEEQNNMTESIPENKYNFLAITECNLSKEDKFIEFIIDSGATENLIKEELEKYMYEIKKLPNKIKIKIANGEILEADKKGKITIRDKNNNTINIEALMVPGIYHNIISVRNLNMKGNKVVFTKFGAQIINGRKVLKCSDRNGLYIVQGEIILIEEANSSVQQDKNIWHQRLGHLNRKSLKIMGLPVSDETCGPCMKGKSTRLPFYPVDRPRSRKIGELLHTDIGGPVSPISYDEKQYYQTITDDFSHFVTVYLLKNKSEATRNLINHIKELERQKETKVKRIRCDNGGEFTAGCLKQFCMENGIIIEYSQPYTPQQNGVAERLNRTLLDKSRTLLSETGLPKYLWSEAIMCAAYQLNRCPSRSIKYKIPAEIYYGLENVNLNKLKVFGSKAWYTCVPQNKKLDNRAEEAIMVGYGKQGYRLWNPKTTEIIFCRDVKFDEKYYEHKNSIKNNNYIYLPEEDTQNEVMCNDKNKIEEEKVIQKNEETDTKRTRSGRIIKQPDYLKNFGTYTAYCYLVCNDPESYEEAIKEVSWKEAIHKELAALENLQSWEETKLPKGKLAIDTKWVFRTKDDGTKKARLVARGFQIKNYENEIFYSPVVRMSTIRAFFVKAIQEGYKLRQLDIPTAFLNGFLDSEVYIKIPKGKENKDGIVLRLKRALYGLKESPKCWNMRFDEFARKNGLIQSLHDCCLYTDKNIWLIIFVDDILLIGMEKDTEKIINKLKQEFKAKDLGQIEKYLGMEIKQEESKLTIKQEKIIEKILEKFGMSECKGIGTPMEVNFQINKNEKIIDVPYRQLIGSIMYLATMSRPDLQFAVSYLSRYLDCPTQQTWKAGKRILQYLKATKDKMLVFQKRNNLDVDLCAYSDSDWAGDIVDRKSVSGGIIMCSDNPVFWYSRKQSCVALSTAESEYIASACCAQELVYLKGVLCDFGYECKLTLFMDNKGAICLAKSNENSKRSKHIDIRMHYIKDLVRNNVLDIEYVSSDKNIADICTKSLCKEKFVFFRSLLLK

Summary

EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01004832    JAG38772.1    GBHO01035173    JAG08431.1    GEZM01072005    JAV65635.1    GEZM01028916    JAV86196.1    GFTR01008662    JAW07764.1    JXUM01155348    KQ572178    KXJ68066.1    ABLF02041793    GBHO01002761    JAG40843.1    GBBI01004033    JAC14679.1    LJIG01022881    KRT78250.1    JXUM01025857    KQ560736    KXJ81076.1    GEHC01000878    JAV46767.1    KF740825    AIC77183.1    JXUM01136904    KQ568499    KXJ68982.1    GEZM01032204    JAV84770.1    GEDC01029908    JAS07390.1    KQ483843    KYP40337.1    JXUM01011189    KQ560325    KXJ83029.1    CM003606    KYP69041.1    KQ483623    KYP44533.1    LBMM01012492    KMQ86193.1    AY009101    AAK12626.1    OIVN01006211    SPD27863.1    GEHC01000959    JAV46686.1    CM003608    KYP66220.1    OIVN01006466    SPD33659.1    GBHO01040663    JAG02941.1    KYP68607.1    GDHC01007678    JAQ10951.1    FJ544856    ACL97386.1    GEZM01063091    JAV69316.1    AC073555    AAG60117.1    OIVN01002473    SPD03944.1    AP002064    BAB01972.1    OIVN01001931    SPC99063.1    KQ460882    KPJ11482.1    KQ485638    KYP31826.1    KQ483702    KYP42748.1    KYP68287.1    FJ544853    ACL97384.1    GFTR01008327    JAW08099.1    KQ483417    KYP53032.1    FJ544851    ACL97383.1    AC007259    AAD50001.1    LBMM01012645    KMQ86082.1    GBHO01024362    JAG19242.1    KQ484038    KYP38095.1    GEZM01044912    JAV78046.1    AC079604    AC079131    AAG50698.1    AAG50765.1    KQ460297    KPJ16236.1    FJ544854    ACL97385.1    AL137898    CAB71063.1    JYDL01000068    KRX18751.1    OIVN01001906    SPC98838.1    KF303287    AGW47867.1    DF973742    GAU39052.1    KK112142    KFM56833.1    OIVN01000486    SPC81000.1    KQ483890    KYP39660.1    KQ459875    KPJ19636.1    GAKP01015342    JAC43610.1    KQ484324    KYP35753.1    KQ484186    KYP36645.1    NWSH01002292    PCG68657.1    PCG68658.1    NKQK01000002    PSS35035.1    GEFH01000951    JAP67630.1    GEZM01017328    JAV90763.1    GDUN01000217    JAN95702.1    GDUN01000215    JAN95704.1    CM003607    KYP67664.1    CM001883    EOY11267.1    CM003610    KYP61818.1    KYP63036.1    GEZM01017329    JAV90762.1    ASHM01015075    PNX96991.1    JYDJ01000136    KRX42725.1    OIVN01006353    SPD31284.1    OIVN01000279    SPC77544.1    KQ483853    KYP40164.1    KL367515    KFD67411.1    KQ483456    KYP50361.1    KYP66838.1    GEHC01000966    JAV46679.1    OIVN01003431    SPD11153.1    AC149291    AAT38758.1    AM433482    CAN69340.1    OIVN01001308    SPC92446.1    ASHM01014140    PNX96091.1    OIVN01004651    SPD18552.1    JYDH01000330    KRY26802.1    CM003613    KYP54398.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF13358   DDE_3
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR038717   Tc1-like_DDE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
3S3N     E-value=2.72757e-07,     Score=136

Ontologies

Topology

Length:
1250
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0131
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00061
outside
1  -  1250
 
 

Population Genetic Test Statistics

Pi
5.556948
Theta
150.478937
Tajima's D
-0.862012
CLR
129.80285
CSRT
0.163941802909854
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号