SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04073
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.761
 

Sequence

CDS
ATGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCTCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTACATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAACGTAATATGTTACGCAGACGACACGCTGGTCGTAGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGATCCCTCGTTTGTTGGGGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGATTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGAGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGAAGGCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGCTGCTTCGGTGAGCTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGTTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCTTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCAGCGACGAGTCGTGGAAGGCGATGCTCGACTGCTGCGAGTACACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGACGAGCGGGGGCCAGGGAGGCGGATCTCGCCCTAGCCCTGGCCCTCTAA
Protein
MIGGALERHGVPLYLLRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLNVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLIPRLLGSLAVGVAKLLQRPQRTIAVRVIRDYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVARPSPSVVRARRAQSRRSVLKAWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGELLHRIGAEPTAECYHCGCDLDTAEHTLVACPAWEGWRLVLVAKIGNDLSLPSVVASMLGSDESWKAMLDCCEYTISQKEAAGRVRDAQARRRRAGAREADLALALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    KZ149896    PZC78733.1    + More
KZ150386    PZC71062.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    RSAL01000481    RVE41577.1    D85594    BAA19776.1    RSAL01000109    RVE47213.1    RSAL01003504    RVE40273.1    LBMM01024063    KMQ82623.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01019839    KMQ83438.1    LBMM01005733    KMQ91252.1    LBMM01019838    KMQ83439.1    LBMM01004272    KMQ92618.1    LBMM01006063    KMQ90967.1    LBMM01002052    KMQ95336.1    LBMM01006662    KMQ90413.1    LBMM01008682    KMQ88705.1    LBMM01007036    KMQ90099.1    LBMM01003245    KMQ93755.1    LBMM01006725    KMQ90373.1    LBMM01004505    KMQ92346.1    LBMM01004634    KMQ92224.1    LBMM01005948    KMQ91066.1    LBMM01015018    KMQ84954.1    LBMM01003988    KMQ92922.1    LBMM01015025    KMQ84953.1    LBMM01009738    KMQ87908.1    LBMM01021647    KMQ83033.1    LBMM01007425    KMQ89740.1    LBMM01008448    KMQ88867.1    LBMM01008422    KMQ88894.1    LBMM01008861    KMQ88580.1    LBMM01005216    KMQ91703.1    LBMM01002480    KMQ94776.1    LBMM01014956    KMQ84982.1    LBMM01006110    KMQ90925.1    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    LBMM01012412    KMQ86235.1    QOIP01000010    RLU18098.1    QOIP01000031    RLU14697.1    GGMR01000779    MBY13398.1    LBMM01005465    KMQ91492.1    LBMM01014122    KMQ85315.1    GL450953    EFN80213.1    LBMM01007659    KMQ89538.1    LBMM01006496    KMQ90570.1    KMQ94772.1    LBMM01008278    KMQ89009.1    ABLF02006132    GGMR01014195    MBY26814.1    LBMM01005474    KMQ91485.1    LBMM01014132    KMQ85305.1    GFXV01002090    MBW13895.1    ABLF02005203    ABLF02041316    ABLF02014378    GGMR01015159    MBY27778.1    GGMR01015354    MBY27973.1    ABLF02034925    ABLF02011238    ABLF02004597    ABLF02041324    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GFXV01001748    MBW13553.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02016435    ABLF02016436    ABLF02064751    ABLF02004854    ABLF02041317    LBMM01004261    KMQ92650.1    LBMM01004262    KMQ92649.1    GGMR01019609    MBY32228.1    ABLF02016340    KQ972691    KXZ75807.1    KXZ75805.1    AB593321    BAK38639.1    KQ972544    KXZ75869.1    ABLF02041886   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D
PDB
5IRG     E-value=0.0246201,     Score=88

Ontologies

Topology

Length:
420
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0874000000000001
Exp number, first 60 AAs:
0.00738
Total prob of N-in:
0.00394
outside
1  -  420
 
 

Population Genetic Test Statistics

Pi
64.432888
Theta
51.73468
Tajima's D
3.31845
CLR
0
CSRT
0.989750512474376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号