SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04069
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 2.163
 

Sequence

CDS
ATGGACCCGGATCCACAGACGTCATTTGACGTACGAAAATTAAATTTTAAAGTCCCAACATTTTCACCGGACGATCCTGAGATTTGGTTCGCATTACTTGAAGGACAGTTCGAAAACTTCGGCATAACTGACGACCATGCGAAGTTCAACCAAGTAATTACGAACTTGGATATCGTGCACGCCAAGGCCGTCAAGGATATTATCGTTAACCCTCCTGCAAGACACCGGTACGATAAGGTGAAATTCGAGCTCATCAAGCGTCTCACCGCCTCGCATGAGAACAAGGTCAGGCAGCTGCTGACACATGAGGAACTGGGTGACAGGAAAGCATCCCAATTTCTCCGACACCTGCAAGATTTAGCAGGACCGGATGTTCCAGAGGAGTTCCTGAGGTCGATTTGGAGCAACCGGTTACCGCCCAGCATCCAGACAGTACTGGCATCGCAGTCGTCTCAGAGGCTGGAGGACTTAGCAGAACTGGCAGATCGCATACAGGAGATAACGTCCCCACCTCAGCTTGCAGCAACGTCGGCGCAGGTTGTAGAAACAGGCAGCACTGGACCTGGCAGTACCGTATCGGGCGAAATCGCTGAGCTCAGAAAAATGTTTCTGGTCGACACGGGTAGCGACCTCTGTGTTTTCCCCCGATCTCAACTACAAGAGCGTCGAGCATCCACCTCTTACAAGCTGATGGCGGCCAACGGAACTACAATTAACACATATGGGTATGTGCACCTGACGTTGGACTTCGGACTCCGTCGTAACTACCCATGGCGTTTCGTGGTGGCTGATGTCACCAATTCTATTATAGGTGTTGATTTTCTGGCATATTATAACCTTATTGTAGATTGTAAATGTAAAAAATTAATTGACAACACTACCACTCTCTCTGCTCCAGCTTCACTGGCTAGTAAATGTAATTCAATTTTGTCTGTAAAAGTTCATACTGGTGACACACATTACCATCAATTACTTTCGCGAGAATTTCCTGAAGTCACACGTCCGGCTGGTACGCAGCGTAGCATTCCACACAACACTCAACACCATATACGCACCACACCTGGTCCTCCCGTATCGTGTGCGCCTAGACGTCTTGCTCCCGACAAGCTAAAGATCGCGAAAGCCGAATTTGAAGCGATGCTAGCAAACGGTACCGCTAGGCCGTCGGAGAGCCCTTGGTCGTCCCCATTACATCTGGTCCCCAAGAAGGACAACGGGTGGCGTCCATGTGGCGACTATAGAAAACTCAACGCTCGCACAATACCGGATATGTACCCCATCAGACATTTACATGATTTCACACATAACATTGCAGGTTGTCGCGTATTCAGCACGATCGATTTGGTAAAAGCCTACAACCAAATCCCCGTATTTGAAGAGGATGTACCGAAGACGGCTATAACCACCCCGTTTGGAATGTTTGAATTCCCATTCATGAACTTTGGACAAAGAAATGCGGGTCAAACATTCCAACGCTTTCTCGATGAGATGATGCGTGGCCTTGATTTCGTCTACTGTTTCATCGATGACTTTTTAATTTTTAGCAGAGACGAGGCCCAGCACGAACATCACCTCCGACAAGTGTTCAGCAGGCTCAAAGACTATGGAATGGTCGTAAATGTTTCCAAGTGTGTTTTCGGAGCTCCCGAAGTAACCTTCTTGGGTTACTGTGTATCGGAGAGCGGCACCAAGCCCTTGGAAGACAAAGTACGTGCCATACTTGACTTTCCCCCACCTCAGAACGTTAAGACACTGAGAAGGTTTCTCGGCATGGCCAATTTTTATCGGCGTTTCTTGCCCAAGGCCGCCGAAATCCAAGCCCCTCTTAACGCTCTTCTCACTGGGTCAGTAAAAGGGTCCACGCCCATCAGTCTCGTAGGCGACGCTCTGAAGGCTTTCGAAGACACCAAGAAAAGCCTCTCCAATGCAGCTCTTTTGGCTCACCCAAAATGTGATGCCAAGCTAGCGTTGGTAACAGACGCGTCAGACAAGGCTATCGGCGCTGTTCTTCAACAGCTAGATGATGAAGCGTGGCAGCCTCTTGCGTATTTTTCACGAAAATTGAGCCCAAGCCAAACCAAATATTCTCCTTACGACCGTGAGCTTCTGGCGATCTACGAAGCCATCAAATACTTTCGGCACATGGTAGAAGCCAGACATTTCACAATCTACACGGACCATAAGCCGATCAGTTATGCCTTCCACGAACGGAAGCATGACTGCTCGCCCAGACAATTCCGACATTTGGACTACATCTCCCAATTCACCACCGATATCAGACATATTTCAGGCAGTAATAACATCGTTGCTGATGCACTTTCACGAGTGGATGAATTGGAGTCTCCAATTGATCTGACGGACCTCAGTCTAGCACAGCATAATGATTCAGAGCTCGCCAAACACCTTCATAACTCATCTTTGCGACTTCAGAAGATGGACTTTCCAGGTAGTCAAAAACCATTATTCTGTGACGTTAGCACTTCGGTGCCTAGACCTTTCATTACCGAACAGTTTCGCAGACAGGTATACCAAAGTCTTCACTCACTCTGTCACCCCGGCCCTAACGCTACAGCCAAGTTAGTAGCTCAGCGCTTCGTGTGGCCCGGGATGAGGAAGGATTGCAGAGACTGGGCACGATCTTGTTTGTCATGTCAACGCGCAAAAGTAAGCCGTCACGTGCATACACCGCTAGGTACTTACGACTTACCACGCGCACGCTTCACTAACATCCACATTGACTTAATCGGTCCACTACCTGTCTCCCAGGGATTTAGGTATTGCCTGACGGCCATTGACCGATTTACACGGTGGCCCGAGGTCATACCAATAGTAGACATCACTGCAGAAACGGTGGCTAAAGCACTAATATCCGGCTGGATATCCAGATTCGGTGTACCAATTGATATTGTCACAGACCGCGGACGACAGTTCGAGTCCGCACTGTTTCAATATTTGTCAAAAGTCTCGGGTTTCCGGCATAAACGCACTACCGCCTATCATCCAGCGTGCAACGGACTCGTGGAACGCTTCCACAGACAGTTAAAAGCGTCCATAACGTGCCACGCTGACTCCAACTGGTCCGAAGTACTGCCGTTGGTACTCCTCGGCATTCGCAGTGCCTTCAAAGAGGATTTACAATCCTCCTCCGCCGAATTACTGTATGGTGAACCGCTCAAATTACCGGGAGAATTTTTCGATTCGAGCACACCTTTTTAA
Protein
MDPDPQTSFDVRKLNFKVPTFSPDDPEIWFALLEGQFENFGITDDHAKFNQVITNLDIVHAKAVKDIIVNPPARHRYDKVKFELIKRLTASHENKVRQLLTHEELGDRKASQFLRHLQDLAGPDVPEEFLRSIWSNRLPPSIQTVLASQSSQRLEDLAELADRIQEITSPPQLAATSAQVVETGSTGPGSTVSGEIAELRKMFLVDTGSDLCVFPRSQLQERRASTSYKLMAANGTTINTYGYVHLTLDFGLRRNYPWRFVVADVTNSIIGVDFLAYYNLIVDCKCKKLIDNTTTLSAPASLASKCNSILSVKVHTGDTHYHQLLSREFPEVTRPAGTQRSIPHNTQHHIRTTPGPPVSCAPRRLAPDKLKIAKAEFEAMLANGTARPSESPWSSPLHLVPKKDNGWRPCGDYRKLNARTIPDMYPIRHLHDFTHNIAGCRVFSTIDLVKAYNQIPVFEEDVPKTAITTPFGMFEFPFMNFGQRNAGQTFQRFLDEMMRGLDFVYCFIDDFLIFSRDEAQHEHHLRQVFSRLKDYGMVVNVSKCVFGAPEVTFLGYCVSESGTKPLEDKVRAILDFPPPQNVKTLRRFLGMANFYRRFLPKAAEIQAPLNALLTGSVKGSTPISLVGDALKAFEDTKKSLSNAALLAHPKCDAKLALVTDASDKAIGAVLQQLDDEAWQPLAYFSRKLSPSQTKYSPYDRELLAIYEAIKYFRHMVEARHFTIYTDHKPISYAFHERKHDCSPRQFRHLDYISQFTTDIRHISGSNNIVADALSRVDELESPIDLTDLSLAQHNDSELAKHLHNSSLRLQKMDFPGSQKPLFCDVSTSVPRPFITEQFRRQVYQSLHSLCHPGPNATAKLVAQRFVWPGMRKDCRDWARSCLSCQRAKVSRHVHTPLGTYDLPRARFTNIHIDLIGPLPVSQGFRYCLTAIDRFTRWPEVIPIVDITAETVAKALISGWISRFGVPIDIVTDRGRQFESALFQYLSKVSGFRHKRTTAYHPACNGLVERFHRQLKASITCHADSNWSEVLPLVLLGIRSAFKEDLQSSSAELLYGEPLKLPGEFFDSSTPF

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01012479    KMQ86204.1    LBMM01013103    KMQ85815.1    LBMM01013040    KMQ85849.1    + More
LBMM01009142    KMQ88359.1    GFXV01006394    MBW18199.1    LBMM01001181    KMQ96765.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GBXI01017046    JAC97245.1    AAGJ04001742    GBXI01015889    JAC98402.1    LBMM01012567    KMQ86146.1    AAGJ04112098    GEGO01003687    JAR91717.1    GBXI01003773    JAD10519.1    AAGJ04130731    KL363241    KFD51254.1    LBMM01012134    KMQ86388.1    LBMM01008151    KMQ89105.1    LBMM01012160    KMQ86374.1    GEGO01001281    JAR94123.1    KQ971355    EFA07205.2    GFDL01003994    JAV31051.1    GEGO01004686    JAR90718.1    GEDV01001796    JAP86761.1    GEGO01004484    JAR90920.1    GGLE01003443    MBY07569.1    GGLE01001814    MBY05940.1    BK004066    DAA04495.1    GEGO01000286    JAR95118.1    LN877232    CTR11708.1    BK004070    DAA04500.1    CABG01000050    CAZ37786.2    EF426679    ABP48077.1    GEGO01004475    JAR90929.1    GEGO01003506    JAR91898.1    ABLF02030693    ABLF02030697    GACK01008900    JAA56134.1    GDKW01003376    JAI53219.1    MRZV01001828    PIK35719.1    KQ973093    EFA13472.2    GGFK01003442    MBW36763.1    GGFK01003401    MBW36722.1    GEGO01004649    JAR90755.1    KL367655    KFD60653.1    LBMM01012633    KMQ86092.1    JYDT01000067    KRY86703.1    KL367544    KFD65142.1    KL367543    KFD65158.1    KL367778    KFD59660.1    AY013569    AAK07487.1    AY013563    AAK07485.1    GFPF01012375    MAA23521.1    GDHF01001116    JAI51198.1    GDHF01021808    JAI30506.1    AY013565    AAK07486.1    BN000802    CAJ00250.1    DF142933    GAA49140.1    GDHF01014424    JAI37890.1    KL367552    KFD64647.1    RQTK01000577    RUS77485.1    KL367492    KFD69854.1    AAGJ04172791    AAGJ04000250    JYDV01000002    KRZ45603.1    KL367664    KFD60497.1    JYDR01000002    KRY79251.1    GBYB01009311    JAG79078.1    FN356213    CAX83702.1    ABLF02058233    JWZT01001363    KII72172.1    ABLF02007585    GGMR01003899    MBY16518.1    AAZX01004786    AAZX01023279    AY662653    AAT98609.1    FN356212    CAX83701.1    NIVC01003188    PAA52757.1    JYDO01000387    KRZ65366.1    AAZX01006801    AAZX01023483    AAZX01009606    ABLF02057446    ABLF02059301    AAZX01013940    NIVC01004641    PAA46946.1    JWZT01004124    KII64665.1    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JYDJ01000353    KRX36608.1    JYDR01000355    KRY64563.1    KL367479    KFD72009.1    ABLF02005645    ABLF02042063    ABLF02040931    ABLF02040938    KL363373    KFD46409.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF01087   GalP_UDP_transf
PF17917   RT_RNaseH
PF13359   DDE_Tnp_4
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR034132   RP_Saci-like       
IPR005849   GalP_Utransf_N       
IPR001969   Aspartic_peptidase_AS       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR013032   EGF-like_CS       
IPR041373   RT_RNaseH       
IPR027806   HARBI1_dom       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=4.42677e-74,     Score=711

Ontologies

Topology

Length:
1071
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10917
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00339
outside
1  -  1071
 
 

Population Genetic Test Statistics

Pi
251.274756
Theta
2.356401
Tajima's D
3.434002
CLR
0.115121
CSRT
0.994100294985251
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号