SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04059  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010099
Annotation
UDP-glycosyltransferase_UGT40B3_precursor_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 3.181
 

Sequence

CDS
ATGAATTTTCAAACGATTCATTTGTTGGTGTTAAGTGCGCTCGCTTGCGATGCATATAAGATATTGCTCGTGTTTCCGTTCCCTTCGAAAAGCCACGCTATTCTCGGAGAGGGTTACGTCAGGAATCTCCTAAAAGCAGGACATGAACTGACCTACATAACGCCATATCCGAAAGATCCGGCTCCTAATTTACGGATCATCCACATTCCACAGCATGTCTTCGAGGAAAAAATAGACTCCACGTTTACTATAGAAAAGCTAATGGACTACAGTTTTACAGTAATGGAAATGCTTAACATTTTCAAGTCTTTTATTGATACAGCTAATGATACAGTAGCTAATGCGGAAGTACAGCAGCTGATGTTAGATCCGCAGACACATTTTGATGTTGTTATTGCAGAATGGATGGTAACGGAAATATTTAGTGGCTTCAGTGAAATTTTCAACTGTCCACTCATATGGGCATCTTCAATGGAACCACATAGCGTGATATTGCGTTTGATAGACGAGATTCCCCATCCTGCGTATTCATCAAATATGTTAGGGATTTTTGAACCGCCATACAATTTCGTCCAAAGAGCAATAAACACTTCGTTGGAGATTGCGTTAAAAGTAATTAAATGGTTTATCAGTTTAATAGAAGAACGGATTTATAAAGAAGGATTTGCAGCTGCATTCAAAGCAAAAGGTCTCGTTCAGCCTAGCTTGGAGGAATTGAGATACTCTGTTGCTTTGGTTTTGGGAAATTCCCACGTTTCTTCTGGAGCTCCGCTGAAATTGCCACAAAATTACAAGGCTATTGGCGGTTATCATATAGCTGAACAATCTAAGCCATTGCCCAAGGAATTTAAGAATATTTTAGACAACTCGAAGCATGGCGTTATTTATTTCAGTCTAGGATCGGTAGTTTCAAGTAAATCGATGCCTGCAGCAATCAAAAATGGATTATTTGAAATGTTCAGGAGTTTGAAATATACTGTTATATGGAAATTCGAAGATGAATTTCAAAATGTTCCTGACAACGTTCATATCGTAAAATGGGCACCACAGCAAAGCATTCTAGCACATCCTAACTGCATTCTCTTCATCACCCACGGTGGCTTATTGTCTACAACGGAAACATTACATTACGGTGTTCCTATTATTGGAATCCCTTTGTTTGGAGATCAGACTATGAATATCAAGAAGGCTGTCTATAAAGGTATTGGACTAGAAGTGAAACTTAATTTCGATACTCCAAAGAACTTGAAAGCAGCTATAAATGAGGTTTTGTCCAATCAAAAATATCGCGATCGAGTTAAGGAGTTGTCGATGATATATCACGATCGTCCGGTGTCTCCGGGTGCTGAGCTGGTCCACTGGGTGGAGCACGTCGTCAAGACTAAAGGAGCTCTTCACCTGCGCTCACAGGCACTGCACGTGCCTTTGTACCAGAAGCTGTTATTAGATTTAATCTTCGTGTCGTTATTATTGTTCCTTGGTTTTGTATTCTTCGTCAAATTTATGGTGACCCGGCCGTATCCTCGTCTGTCTAGACAGGCAGACTCCATGTTCACTATAGAAAAACTAATAGATAACACTTTTGCACTAAAGGAAATGTTTAGCATTCTCAAGTCTTTTATTGATACAGCTAATGATACAGTATCTAATACGGAAGTACAGCAGCTGATGTTAGATCCGCAGACACATTTTGATGTTGTTATTGCAGAATGGATGCTAACTGAAATTTTTAGTGGCTTCAGTACAATTTTCAACTGTCCACTCATATGGTCATCTTCAATGGAACCACACAGCCCCATATTGCAATTGATAGATGAGATGGTCCATCCGGCGTATTCATCAAACATGCTAGGGCTTTTTGAACCGCCATACAATTTCTTCCAAAGAGCAATAAACACTTTGATAGAGATCGGATTAAAAGTAGCCAAATGGTTTTCCGCTTTGATAGAAGAACAGATTTATAAAGAAGCATTTGCAGCTGCATTCAAAGCAAAAGATCTCGTTCAGCCTAGCTTGGAGGAATTGAGATACTCTGCTGCTTTAGTTTTGGGAAATTCCCACGTTTCTTCTGGAGCTCCGCTGAAATTGCCACAAAATTACAAGGCTATTGGCGGATATCATATAGATGAACAATCTAAACCATTGCCTAAGGAATTTAAGAACATTCTAGACAACTCGAAGCACGGCGTTATTTATTTCAGTCTAGGATCGATAGTTCCAAGTAAATCGATGCCTGCAGAAATCAAAAATGGATTATTTGAAATGTTCAGGAATTTGAAATATACTGTTATATGGAAATTTGAAGATGAATTTCAAAATGTTCCTGACAACGTTCACATCGTAAAATGGGCACCACAGCAAAGCATACTAGCACATCCTAACTGCATTCTCTTCATCACCCACGGTGGCTTATTGTCTACGACGGAAACATTACATCACGGTGTTCCTATTATCGGAATGCCCATATTTGGAGATCAGGCCATGAATGTCAAGAAAGCTGTCCATAAAGGCATTGGACTAGAAGTGAAATTTGACTCGGATACTCCAAAAAATTTGAAAGCAGCTATAAATGAGGTTTTGTCCAATCAAAAATATCGCGATCGAGTTAAGGAGTTGTCGTTGATATATCACGATCGTCCGGTGTCTCCGGGTGCTGAGCTGGTCCACTGGGTGGAGCACGTCGTCAAGACTAAAGGAGCTCTTCATCTGCGCTCACCAGCACTGCACGTGCCTTTGTACCAGAAGCTGTTATTAGATATAATCTTCGTGTCGTTATTGTTGTTCCTTGGTTTTGTATTCTTCGTCAAATTTATGCTGACCCGTGCGCTCGCTTGCGATGCATATAAGATATTGCTCGTGTTTCCGTTCCCTTCGAAAAGCCACGCTATTCTTGGAGAGGGTTACGTCAGGAATCTCCTCAAAGCAGGACATGAAGTGACCTACATAACGCCATATCCGAGAGATCCGGCTCCCAATTTACGGATCATCCAAGTTTCACAGCATGACTTCGAGGAAAAAATTAACTCCACGTTAACCATAGAAAAGCTAATAGACTACAGTTTTACAGTAATGGAAATGTTTAACATTACGAAGTCTTTTATTTATACAGCTAATGATACAGTAGCTAATACGGAAGTACAACAGCTGATGTTAGATCCACAGACACATTTTGATGTTGTTGTTGCAGAATGGATGATAACTGAAATTTTTAGTGGCTTCAGTGTAATTTTCAACTGTCCACTCATATGGTCTTCTTCAATGGAACCACATAGCTGGATATTGCCTTTGATAGACGAGATTCCCCATCCTGCCTATTCATCAAATATATTAGGGCTTTTTGAACCGCCATACAATTTCGTCCAAAGAGCAATAAACACTTCGTTGGAGATTGCGTTAAAAGTAATTAAATGGCTTGTCACTTTAATAGAAGAACAGATTTATAAAGAAGGATTTGCAGCTGCATTCAAAGCAAAAGGTCTTATTCAGCCAAGCTTAGAGGAATTGAGATACTCTGCTGCTTTGGTTTTGGGAAATTCCCACATTTCTTCTGGAGCTCCGCTGAAATTGCCACAAAATTACAAGGCTATTGGCGGTTATCATATAGATGAACAATCTAAGCCATTGCCCAAGGATTTTAAGAACATTCTAGACAACTCGAAGCACGGCGTTATTTATTTCAGTCTAGGATCGATGGCTCCAAGTAAATCGATGCCTGCAGCAATAAAAAACGGATTATTTGAAATGTTTAGGAGTTTAAAATATACTGTTATATGGAAATTCGAAGATGAATTTCAAAATGTTCCTGACAACGTTCACATCGTAAAATGGGCTCCACAGCAAAGCATACTAGCACACCCTAACTGCATTCTCTTCATCACCCACGGTGGCTTATTGTCTACAACGGAAACATTACATTACGGTGTTCCTATTATTGGAATGCCTATGTTTGGAGATCAGGTCATGAATATCAAGAAGGCTGTCCATAAAGGCTTTGGACTAGAAGTGAAACTTAACTTCGATACTCCAAAGAACTTGAAAGCAGCTATAAATGAGGTTTTGTCCAATCAAAAGTATCGCGATCGAGTTAAGGAGTTGTCGTTGATATATCACGATCGTCCGGTGTCTCCGGGTGCTGAGCTGGTCCACTGGGTGGAGCATGTCGTCAAGACTAAAGGAGCTCTCCATCTGCGCTCACAGGCGCTGCACGTGCCTTTGTACCAGAAGCTGTTATTAGATATAATCTTCGTGTCGTTATTGTTGTTCCTTGGTTTTGTATTCTTCATCAAATATATGGTGACCCGGTGTTTGAAGAAGAAAATAGATATTAGAAAAAAAACTTTGTAG
Protein
MNFQTIHLLVLSALACDAYKILLVFPFPSKSHAILGEGYVRNLLKAGHELTYITPYPKDPAPNLRIIHIPQHVFEEKIDSTFTIEKLMDYSFTVMEMLNIFKSFIDTANDTVANAEVQQLMLDPQTHFDVVIAEWMVTEIFSGFSEIFNCPLIWASSMEPHSVILRLIDEIPHPAYSSNMLGIFEPPYNFVQRAINTSLEIALKVIKWFISLIEERIYKEGFAAAFKAKGLVQPSLEELRYSVALVLGNSHVSSGAPLKLPQNYKAIGGYHIAEQSKPLPKEFKNILDNSKHGVIYFSLGSVVSSKSMPAAIKNGLFEMFRSLKYTVIWKFEDEFQNVPDNVHIVKWAPQQSILAHPNCILFITHGGLLSTTETLHYGVPIIGIPLFGDQTMNIKKAVYKGIGLEVKLNFDTPKNLKAAINEVLSNQKYRDRVKELSMIYHDRPVSPGAELVHWVEHVVKTKGALHLRSQALHVPLYQKLLLDLIFVSLLLFLGFVFFVKFMVTRPYPRLSRQADSMFTIEKLIDNTFALKEMFSILKSFIDTANDTVSNTEVQQLMLDPQTHFDVVIAEWMLTEIFSGFSTIFNCPLIWSSSMEPHSPILQLIDEMVHPAYSSNMLGLFEPPYNFFQRAINTLIEIGLKVAKWFSALIEEQIYKEAFAAAFKAKDLVQPSLEELRYSAALVLGNSHVSSGAPLKLPQNYKAIGGYHIDEQSKPLPKEFKNILDNSKHGVIYFSLGSIVPSKSMPAEIKNGLFEMFRNLKYTVIWKFEDEFQNVPDNVHIVKWAPQQSILAHPNCILFITHGGLLSTTETLHHGVPIIGMPIFGDQAMNVKKAVHKGIGLEVKFDSDTPKNLKAAINEVLSNQKYRDRVKELSLIYHDRPVSPGAELVHWVEHVVKTKGALHLRSPALHVPLYQKLLLDIIFVSLLLFLGFVFFVKFMLTRALACDAYKILLVFPFPSKSHAILGEGYVRNLLKAGHEVTYITPYPRDPAPNLRIIQVSQHDFEEKINSTLTIEKLIDYSFTVMEMFNITKSFIYTANDTVANTEVQQLMLDPQTHFDVVVAEWMITEIFSGFSVIFNCPLIWSSSMEPHSWILPLIDEIPHPAYSSNILGLFEPPYNFVQRAINTSLEIALKVIKWLVTLIEEQIYKEGFAAAFKAKGLIQPSLEELRYSAALVLGNSHISSGAPLKLPQNYKAIGGYHIDEQSKPLPKDFKNILDNSKHGVIYFSLGSMAPSKSMPAAIKNGLFEMFRSLKYTVIWKFEDEFQNVPDNVHIVKWAPQQSILAHPNCILFITHGGLLSTTETLHYGVPIIGMPMFGDQVMNIKKAVHKGFGLEVKLNFDTPKNLKAAINEVLSNQKYRDRVKELSLIYHDRPVSPGAELVHWVEHVVKTKGALHLRSQALHVPLYQKLLLDIIFVSLLLFLGFVFFIKYMVTRCLKKKIDIRKKTL

Summary

Similarity
Belongs to the UDP-glycosyltransferase family.
Uniprot
Pfam
PF00201   UDPGT
Interpro
IPR035595   UDP_glycos_trans_CS        + More
IPR002213   UDP_glucos_trans       
ProteinModelPortal
PDB
2O6L     E-value=3.61102e-25,     Score=290

Ontologies

Topology

SignalP
Position:   1 - 18,         Likelihood:  0.936539
 
 
Length:
1447
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
72.3489900000001
Exp number, first 60 AAs:
5.42724
Total prob of N-in:
0.24717
outside
1  -  480
TMhelix
481  -  503
inside
504  -  915
TMhelix
916  -  935
outside
936  -  1408
TMhelix
1409  -  1428
inside
1429  -  1447
 
 

Population Genetic Test Statistics

Pi
211.901372
Theta
181.259118
Tajima's D
0.986303
CLR
0.002335
CSRT
0.655717214139293
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 ILLVFPFPSK 100.00 3e-04
28556443 ILLVFPFPSK 100.00 3e-04
28556443 ILLVFPFPSK 100.00 3e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号