SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04058
Pre Gene Modal
BGIBMGA010099
Annotation
UDP-glycosyltransferase_UGT40B4_precursor_[Bombyx_mori]
Full name
UDP-glucuronosyltransferase      
Location in the cell
Cytoplasmic   Reliability : 1.982 PlasmaMembrane   Reliability : 1.34
 

Sequence

CDS
ATGTTAGATCCGCAGACACATTTTGATGTTGTTATTGCAGAATGGATGGTAACTGAAATTTTTAGTGGCTTCGGTAAAATTTTCAACTGTCCATTCATATGGTCATCTTCAATGGAAGCACATAGCTTGATATTGCGTTTGATAGACGAGATTCCCCATCCTGCGTACTCATCAAACACGCTAGGGCTTTTTGAACCACCATACAATTTCTTCCAAAGAGCAATAAACACTTTGATGGAGATTGGATTAAAAGTAGCCAAATGGTTTTCCATTTCAATAGAAGAACATATTTATAAAGAAGGATTTGCTGCTGCATTCAAAGCAAAAGGTCTCGTTCAGCCTAGCTTGGAAGAATTGAGATACTCTGCTGCTTTGGTTTTGGGAAATTCCCACGTTTCTTCTGGAGCTCCGCTGACATTGCCACAAAATTACAAGGCTATTGGTGGTTATCATATAGACGAACAATCTAAGCCATTGCCCAAGGAATTTAAGAATATTTTAGACAACTCGAAGCATGGCGTTATTTATTTCAGTCTAGGATCGGTAGTTTCAAGTAAATCGATGCCTGCAGCAATCAAAACCGGATTATTTGAAATGTTCAGGAGTTTAAAATATACTGTTATATGGAAATTCGAAGATGACTTTCAAAATATTCCTGATAACGTTCACGTCGTAAAATGGGCACCACAGCAAAGCATACTAGCACATCCTAACTGCATTCTCTTCATCACCCACGGTGGCTTATTGTCTACAACGGAAACATTACATTACGGTGTTCCTATTATTGGAATACCCATATTTGGAGATCAGGTCATGAATATCAAAAAGGCTGTCCATAAAGGCATTGGACTAGAAGTGAAACTTGACTTGGATACTCCAAAGAACTTGAAAGCAGCTATAAATGAGGTTTTGTCCAATCAAAAGTAA
Protein
MLDPQTHFDVVIAEWMVTEIFSGFGKIFNCPFIWSSSMEAHSLILRLIDEIPHPAYSSNTLGLFEPPYNFFQRAINTLMEIGLKVAKWFSISIEEHIYKEGFAAAFKAKGLVQPSLEELRYSAALVLGNSHVSSGAPLTLPQNYKAIGGYHIDEQSKPLPKEFKNILDNSKHGVIYFSLGSVVSSKSMPAAIKTGLFEMFRSLKYTVIWKFEDDFQNIPDNVHVVKWAPQQSILAHPNCILFITHGGLLSTTETLHYGVPIIGIPIFGDQVMNIKKAVHKGIGLEVKLDLDTPKNLKAAINEVLSNQK

Summary

Catalytic Activity
glucuronate acceptor + UDP-alpha-D-glucuronate = acceptor beta-D-glucuronoside + H(+) + UDP
Similarity
Belongs to the UDP-glycosyltransferase family.
Feature
chain  UDP-glucuronosyltransferase
EC Number
2.4.1.17
EMBL
JQ070251    AEW43167.1    JQ070249    AEW43165.1    JQ070248    AEW43164.1    + More
JQ070250    AEW43166.1    BABH01011829    BABH01011830    BABH01011820    AF324465    AAL55994.1    JQ070247    AEW43163.1    RSAL01000210    RVE44215.1    AB539965    BAJ08155.1    ODYU01000116    SOQ34342.1    KZ149930    PZC77368.1    JQ070253    AEW43169.1    JQ070214    AEW43130.1    ODYU01004685    SOQ44830.1    KF777115    AHY99686.1    KU680303    ANI22009.1    PZC77366.1    ODYU01005852    SOQ47145.1    KF777116    AHY99687.1    JQ070252    AB539964    AEW43168.1    BAJ08154.1    JQ070207    AEW43123.1    KU214508    AMK97474.1    KY202932    AUC64276.1    RVE44216.1    KU680295    ANI22001.1    JQ070213    AEW43129.1    GEYN01000085    JAV02044.1    NWSH01002698    PCG67661.1    KU680302    ANI22008.1    JQ070254    AEW43170.1    AB539967    BAJ08157.1    KQ459582    KPI98793.1    BABH01011776    BABH01011777    BABH01011778    FJ373022    ACQ66003.1    ODYU01009829    SOQ54516.1    KU680294    ANI22000.1    PZC77367.1    KY202937    AUC64281.1    NWSH01000282    PCG77782.1    GEYN01000076    JAV02053.1    KU680304    ANI22010.1    KQ460597    KPJ13897.1    KU214507    AMK97473.1    JQ070255    AEW43171.1    KPI98794.1    BABH01011785    BABH01011786    BABH01011787    JQ070208    AEW43124.1    AB539963    BAJ08153.1    AGBW02012922    OWR44215.1    PCG77781.1    AGBW02007992    OWR54346.1    ODYU01010264    SOQ55252.1    KQ460075    KPJ17950.1    JTDY01003050    KOB70242.1    KPI98725.1    JQ070256    AB539969    AEW43172.1    BAJ08159.1    RSAL01000067    RVE49308.1    KU680296    ANI22002.1    KY202925    AUC64269.1    ODYU01012744    SOQ59206.1    KF777113    AHY99684.1    AGBW02009118    OWR51610.1    AK404892    BAM20357.1    JQ070210    AEW43126.1    KU680298    ANI22004.1    PZC77369.1    SOQ44829.1    RVE49311.1    PZC77370.1    JQ070212    AEW43128.1    KPJ17977.1    KU680297    ANI22003.1    RVE49310.1    JQ070258    AB539968    AEW43174.1    BAJ08158.1    KU680301    ANI22007.1    NWSH01003535    PCG66153.1    BABH01011784    AK402777    BAM19379.1    NWSH01003979    PCG65597.1    KQ459356    KPJ01283.1    PZC77371.1    ODYU01006413    SOQ48233.1    JQ070211    AEW43127.1    AB539966    BAJ08156.1    JQ070257    AEW43173.1    NWSH01003818    PCG65793.1    GEYN01000100    JAV02029.1    KF777114    AHY99685.1    KU680300    ANI22006.1    KY202946    AUC64290.1    KPJ13896.1    GEYN01000087    JAV02042.1    PZC77372.1    KU680299    ANI22005.1   
Pfam
PF00201   UDPGT
Interpro
IPR002213   UDP_glucos_trans        + More
IPR035595   UDP_glycos_trans_CS       
PDB
2O6L     E-value=1.66068e-19,     Score=235

Ontologies

Topology

Subcellular location
Membrane  
Length:
308
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.0327
Exp number, first 60 AAs:
0.65702
Total prob of N-in:
0.02322
outside
1  -  308
 
 

Population Genetic Test Statistics

Pi
188.616091
Theta
176.575234
Tajima's D
0.370493
CLR
0.391083
CSRT
0.47767611619419
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号