SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04057  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010294
Annotation
UDP-glycosyltransferase_UGT40A1_[Bombyx_mori]
Full name
UDP-glucuronosyltransferase      
Location in the cell
PlasmaMembrane   Reliability : 1.505
 

Sequence

CDS
ATGTTAAGGGCAATTATATTGTGCTTGATATTAGTGACATGTAGTGCATACAAATTGTTAGCTGTTTTTCCGTTCCCTGGGAAGAGTCACATGATTTTAGGTGAAGGATATGTAAGGCTTCTCTTGGAGGCTAATCACGATGTAACGTACTTAACGCCTGCTCCACTAAAGATTGGTCATCCAAAATTAAGACAGATCGATGTATCTTCAACCGAAAAGGGTTTTGATTTCGATGGCCTGTTCAACTTTAAGAAGTTGATTAACAAAGAAGTCGATCTATCAGATACGAATCACAAGTATATCGTAATGCAATATGTAACCGAGTCATTGTTAATGCATCCCAACGTACAAAAACTGCTTTTGGATACAGATCAAACGTTTGATGCCGTGATTGTTGAGTGGATGTATAGCGACTTGTATTCTGGGTTTTCAACTGTCTTCAACTGTCCATTTATTTGGTCGTCATCGCTGGAGCCCCATCCCATGATCCTTAGGCTTATTGATTCTTTACCGAATCCAGCTTACTTTCCTGATCATACTTCATCCTTAGAACCTCCCTACACATTTCTAGAGCGTGTTGAACAATTATGGAACATTGCTAAAACTTTATACAACAGATGGAGATTGAAAGAAAAAGAAGAAAGTATTTACGAGAATGCGTTTGGACCAGCCGTTAAGAAACGAAACAGAGTTTTACCACCATACAACGAAGTGAAGTATAATGGATCATTGATTTTGGGAAATTCTCACGTGTCTACTGGAGTTGCTTTTAGTCTTCCTCAGAATTACAAGGCGATCTCAGGATATTATATACCGAAAAAAATACCACAGTTGCCCGATAAAATAAAAAATATCATGGACAAAGCAGAAAATGGTGTAATTTACTTCAGTATGGGAACAATGGTAAAAAGCAAAACATTACCAGAAGAATTGAAACGGAACCTAGTAGATATGTTTGGAAATCTAAAACAAACCGTTATATGGAAATTTGAGGAAGACTTAGATGGATTACCAAATAATGTGCATATTGTATCGTGGGCGCCGCAGCAAAGTATTCTTGCTCATCCCAACTGCGTGCTATTCATCACTCATGGCGGCTTACTGTCTACAACTGAGGCACTACACTATGGGGTCCCTATAATAGGGATCCCAGTTTTTGCCGACCAATTTCTCAACATCAAAAGAGCAACCACAAAAGGATTTGCCCTCGAAGTTGACATTAACTATGAAACACCAGGAAACTTAAAGTTGGCGATCGATGAAATTTTGAACAGCCCTAAATATCGTGAAAACATTAAGCAGCTATCGCTGGTCTACCACGATCGTCCGGTGTCTCCTGGTGCCGAGCTGGTCCACTGGGTGGAGCACGTCGTCAAGACTAAAGGAGCTCTCCATCTGCGCTCACCAGCACTGCACGTGCCTTTCTACCAGAAGCTGTACTTAGATCTTTTTGCTGTAATTTTAATGATGCCATTGGTTTTATGCATACTTCTGAGGTATATGAAAAATAAATTATTCGGTGTTATAAAAAAGAAGGGAAAGAAGACAAAAAAGAATCAGTAA
Protein
MLRAIILCLILVTCSAYKLLAVFPFPGKSHMILGEGYVRLLLEANHDVTYLTPAPLKIGHPKLRQIDVSSTEKGFDFDGLFNFKKLINKEVDLSDTNHKYIVMQYVTESLLMHPNVQKLLLDTDQTFDAVIVEWMYSDLYSGFSTVFNCPFIWSSSLEPHPMILRLIDSLPNPAYFPDHTSSLEPPYTFLERVEQLWNIAKTLYNRWRLKEKEESIYENAFGPAVKKRNRVLPPYNEVKYNGSLILGNSHVSTGVAFSLPQNYKAISGYYIPKKIPQLPDKIKNIMDKAENGVIYFSMGTMVKSKTLPEELKRNLVDMFGNLKQTVIWKFEEDLDGLPNNVHIVSWAPQQSILAHPNCVLFITHGGLLSTTEALHYGVPIIGIPVFADQFLNIKRATTKGFALEVDINYETPGNLKLAIDEILNSPKYRENIKQLSLVYHDRPVSPGAELVHWVEHVVKTKGALHLRSPALHVPFYQKLYLDLFAVILMMPLVLCILLRYMKNKLFGVIKKKGKKTKKNQ

Summary

Catalytic Activity
glucuronate acceptor + UDP-alpha-D-glucuronate = acceptor beta-D-glucuronoside + H(+) + UDP
Similarity
Belongs to the UDP-glycosyltransferase family.
Feature
chain  UDP-glucuronosyltransferase
EC Number
2.4.1.17
EMBL
JQ070247    AEW43163.1    AF324465    AAL55994.1    NWSH01002698    PCG67661.1    + More
ODYU01000116    SOQ34342.1    JQ070213    AEW43129.1    KU214508    AMK97474.1    KU680302    ANI22008.1    AB539967    BAJ08157.1    JQ070254    AEW43170.1    AB539963    BAJ08153.1    JQ070255    AEW43171.1    BABH01011785    BABH01011786    BABH01011787    KQ459582    KPI98793.1    JQ070250    AEW43166.1    RSAL01000210    RVE44215.1    KY202932    AUC64276.1    JQ070251    AEW43167.1    KF777115    AHY99686.1    KU680303    ANI22009.1    KZ149930    PZC77368.1    KY202937    AUC64281.1    KQ460597    KPJ13897.1    KF777116    AHY99687.1    JQ070214    AEW43130.1    ODYU01004685    SOQ44830.1    ODYU01009829    SOQ54516.1    JQ070253    AEW43169.1    KU680294    ANI22000.1    JQ070207    AEW43123.1    JQ070252    AB539964    AEW43168.1    BAJ08154.1    FJ373022    ACQ66003.1    NWSH01000282    PCG77782.1    PZC77366.1    RVE44216.1    GEYN01000076    JAV02053.1    KU680304    ANI22010.1    GEYN01000085    JAV02044.1    PCG77781.1    PZC77367.1    ODYU01005852    SOQ47145.1    JQ070256    AB539969    AEW43172.1    BAJ08159.1    ODYU01012744    SOQ59206.1    KU680295    ANI22001.1    KU214507    AMK97473.1    JQ070249    AEW43165.1    AGBW02007992    OWR54346.1    JQ070208    AEW43124.1    JQ070248    AEW43164.1    KQ460075    KPJ17950.1    JQ070210    AEW43126.1    KF777113    AHY99684.1    KY202925    AUC64269.1    KPJ17977.1    PZC77369.1    KU680296    ANI22002.1    NWSH01003535    PCG66153.1    RSAL01000067    RVE49310.1    KPI98725.1    KU680297    ANI22003.1    KPI98794.1    GEYN01000100    JAV02029.1    KU680298    ANI22004.1    AB539965    BAJ08155.1    JQ070258    AB539968    AEW43174.1    BAJ08158.1    JQ070212    AEW43128.1    KU680300    ANI22006.1    KY202946    AUC64290.1    AK402777    BAM19379.1    KQ459356    KPJ01283.1    AK404892    BAM20357.1    PZC77370.1    NWSH01003979    PCG65597.1    RVE49311.1    KF777114    AHY99685.1    KU680301    ANI22007.1    RVE49308.1    JTDY01003683    KOB69154.1    PZC77371.1    AGBW02009118    OWR51610.1    NWSH01003818    PCG65793.1    KU680299    ANI22005.1    KPJ13896.1    AGBW02012922    OWR44215.1    JQ070209    AEW43125.1    JQ070211    AEW43127.1    SOQ44829.1    ODYU01010264    SOQ55252.1    AB539966    BAJ08156.1    JQ070257    AEW43173.1    ODYU01006413    SOQ48233.1    PZC77372.1    GEYN01000087    JAV02042.1    JTDY01003050    KOB70242.1   
Pfam
PF00201   UDPGT
Interpro
IPR002213   UDP_glucos_trans        + More
IPR035595   UDP_glycos_trans_CS       
PDB
2O6L     E-value=6.6114e-28,     Score=310

Ontologies

Topology

Subcellular location
Membrane  
SignalP
Position:   1 - 16,         Likelihood:  0.956859
 
 
Length:
520
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
42.54815
Exp number, first 60 AAs:
20.53795
Total prob of N-in:
0.93903
POSSIBLE N-term signal
sequence
inside
1  -  4
TMhelix
5  -  27
outside
28  -  478
TMhelix
479  -  501
inside
502  -  520
 
 

Population Genetic Test Statistics

Pi
202.071178
Theta
161.113387
Tajima's D
0.374871
CLR
149.486191
CSRT
0.470526473676316
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号