SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04055
Annotation
PREDICTED:_uncharacterized_protein_LOC103311346_[Acyrthosiphon_pisum]
Location in the cell
PlasmaMembrane   Reliability : 1.34
 

Sequence

CDS
ATGGTCACAGTTGACGTACGCCCGGACGAGATCACACGTAATCCTACCTTCGAGTCTAGCACTGCAGCCTCCACTAATGCGTATGTGGGCTACAGTCGCTCGGTAGTTCTTTTGGGTACTTGTGTAGTTCGCGTTCGTCATCCTCGCAGTACTAATCAATCATTTCTTGTACGTGCGTTGATTGATAGTGGTGCTCAAGATTGTTTCATTACCAAGTCATGTTGTCAACGTTTGGGCTTACCATTACGTCGCTGTCCATTAGCCGTAGTTGGTCTAGGTCAAAATGCTGTACATCACGTGACTGGAGTTACTTCTTGCACTGTACTTTCTCGTACTTCAGAAAATCCTCATTTCAACATTAATCCTATCGTAGTAAATACTATAACGAGTAAAATGCCTGCTACAAACTTACCTACTAATCTTCGTGATTCTTTTAAACATCTGGTCCTCGCAGATGAGAATTTTGATAAACCATCAAATGTAGATTTACTACTTGGCGCAGAACTGTTCCATAGTATTTATGACGGTCAACGCGTTCAGCCCAGTCATAACCTACCGGTAGCTTTACACAGCGTGTTTGGTTGGGTCATCACCGGCAAACTTAATACAAACTATTTACCTCCGCCAACAATATCTTCTCTCTTAGCATCCACACGTTCTCTGGACGAGGGACTCAAGCGATTCTGGGAGATAGAAGAACCTCCAAGTCAGGTTATCTTAAACCCTGAAGATATTAAATGTGAACAAATGTACTCAAATCTAACGTATCGTAATCCCGACGGCAGGTATGTTGTACCTATGCTTCTCAAAGAACCTATCAGTCAACTAGGCGATTCTTTCAACCAATCTTTCTCTCGGCTCGTTAACATAGAACGACGCCTTGATCGAAACTTAGAGTTGAAAAAAGAGTACACCGCGTTTATGCGCGAATACAAGTTGTTAGGGCATATGGAGCTTAGCGCTGACTCGAATAAAACCGGGCAGTATATAATTCCTCATCATTGTGTCATTCGTCCGGAAAGTACAACGACTAAACTTAGGGTTGTATTTGATGCTAGCGCCAAAACTACCAATGGCAAATCTCTTAACGATCTTGTATATACTGGTCCAAAACTTCAAAACGATATAGGAGATATACTTACAAAATTTCGGTTGTATGCTGTTGTTTTTACTGCCGACATCAGTAAGATGTATCGAAACATCGAACTCAGGCCAGAAGACCGAAGATGGCAGCATATACTTTGGCGCGATTCTCCTTCTGATCCTGTAACTGAGTATGAGCTGAAAACGGTAACCTACGGGGTTACGAGTTCCCCTTATCTGGCAATACGTACTCTGCATCAATTAGCCTCTGACTACGAAAAAGAGTGGCCCTTAGCTGCTGCTAGTCTTCGTCATGATACTTTCATGGATGACATCACTGTTGGAGCTACATCTATTGAAACTGCACTGAAACATAAAGAAGAGTTAATACAAATGTTAGCGTGTGCTAAGTTCGAATTACGTAAATGGAGTAGCAACTCACCCGAATTCCTCACCCAGATACCAACGGAACATTGTCAGGTTCCAAAAACATTTTGTGATGAAAAACAAAAACAAAGTATCAAGATTCTTGGAGTCCAATGGGATCCAGCTGATGATAACTTTACTTATGCTTTATCAGAACTCGCTCCAGGGAATACAAAACGTGCTATTCTATCAAACGTCGCCAGAATTTATGATCCACTCGGATGGTTGGCCCCAATGGTTCTAATAGCTAAGCTTACCTTACAAGAACTATGGCGTCTTCAGCTTGACTGGGATGAAACTGTACCGTCAGATATGTTGTCTCAGTGGCATCTATTTACATCTGAGTTTCACTATCTGAAGGATGTTAAAATTCCTCGACTAATTGTACCTCTTCATTCAAAATCATACGAACTTGTAGGTTTTTGTGATGGATCTACCAAGGCTTATGGTTGTTCTGTGTACTTACGTATAACTACCGACAGTGAAATTACATCTCACTTGCTTATTGCAAAATCTAAAGTAGCTCCATTAAAAGTTCTTACTGTCAACCGATTGGAGCTATGTAGTGCTGTATTATTAGCAAAAATGTTGAAGCATATTAGTAATTTACTAAATGAAACTCAAACCTCAAACATAACAATTTCAAAGATATGGGCATTCACTGATAGCTCAACTGTACTATCATGGCTGCAAACAGCACCTCATCGTCTTAAAACTTTCGTTGCACACCGTGTCGTGAAGCTGTTAGATAATTTGTCTGTCGAAAATTGGTATCACGTGTCAACGTATGATAATCCAGCAGATTACTGCAGTCGTGGTCTTACCTGCTCTCAGCTTGTGGCTTGTTCCACTTGGTGGACAGGACCCAAATGGATAGTCTCGAATTCTTCTACATGGCCGGTGTCTGACAAATTACCTTATTTAAAGGAATTAGCCGAACTGGGAGATATAGTTATGATCGTGGATCAAAACCTTCCACCGTTGGAATGGCGTATCGGCAGAATTAGCATAATTCATCCCGGTTCTGATGGCGTAGTACGGGTTGTCACTGTCCAAACAGCTCACGGTCTGCTGCGCCGACCAGTTACAAAGTTGTGTCCTTTGCCAATTCACGAAAACTTGTAA
Protein
MVTVDVRPDEITRNPTFESSTAASTNAYVGYSRSVVLLGTCVVRVRHPRSTNQSFLVRALIDSGAQDCFITKSCCQRLGLPLRRCPLAVVGLGQNAVHHVTGVTSCTVLSRTSENPHFNINPIVVNTITSKMPATNLPTNLRDSFKHLVLADENFDKPSNVDLLLGAELFHSIYDGQRVQPSHNLPVALHSVFGWVITGKLNTNYLPPPTISSLLASTRSLDEGLKRFWEIEEPPSQVILNPEDIKCEQMYSNLTYRNPDGRYVVPMLLKEPISQLGDSFNQSFSRLVNIERRLDRNLELKKEYTAFMREYKLLGHMELSADSNKTGQYIIPHHCVIRPESTTTKLRVVFDASAKTTNGKSLNDLVYTGPKLQNDIGDILTKFRLYAVVFTADISKMYRNIELRPEDRRWQHILWRDSPSDPVTEYELKTVTYGVTSSPYLAIRTLHQLASDYEKEWPLAAASLRHDTFMDDITVGATSIETALKHKEELIQMLACAKFELRKWSSNSPEFLTQIPTEHCQVPKTFCDEKQKQSIKILGVQWDPADDNFTYALSELAPGNTKRAILSNVARIYDPLGWLAPMVLIAKLTLQELWRLQLDWDETVPSDMLSQWHLFTSEFHYLKDVKIPRLIVPLHSKSYELVGFCDGSTKAYGCSVYLRITTDSEITSHLLIAKSKVAPLKVLTVNRLELCSAVLLAKMLKHISNLLNETQTSNITISKIWAFTDSSTVLSWLQTAPHRLKTFVAHRVVKLLDNLSVENWYHVSTYDNPADYCSRGLTCSQLVACSTWWTGPKWIVSNSSTWPVSDKLPYLKELAELGDIVMIVDQNLPPLEWRIGRISIIHPGSDGVVRVVTVQTAHGLLRRPVTKLCPLPIHENL

Summary

EMBL
GALX01004947    JAB63519.1    GBHO01006408    JAG37196.1    GBRD01007977    JAG57844.1    + More
GGMR01018294    MBY30913.1    ABLF02026240    ABLF02055027    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GFTR01008866    JAW07560.1    GBHO01044316    JAF99287.1    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    ABLF02025193    GGMR01017890    MBY30509.1    ABLF02030854    ABLF02067347    ABLF02041762    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LBMM01012238    KMQ86334.1    ABLF02008594    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GECZ01008071    JAS61698.1    ABLF02066034    GGMR01006575    MBY19194.1    GBHO01038800    JAG04804.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    ABLF02003339    ABLF02058001    GGMS01012504    MBY81707.1    GDHC01018192    JAQ00437.1    GGMR01003897    MBY16516.1    GBHO01000061    JAG43543.1    GBHO01000060    JAG43544.1    GBHO01000059    JAG43545.1    GEBQ01015737    JAT24240.1    GEZM01054766    GEZM01054765    JAV73410.1    GGMR01016460    MBY29079.1    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02005684    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GEBQ01028569    JAT11408.1    GEBQ01015458    JAT24519.1    JAV73413.1    GEBQ01000825    JAT39152.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GBHO01007689    JAG35915.1    GDHC01014268    JAQ04361.1    GDHC01016272    JAQ02357.1    GAMC01006864    JAB99691.1    GGMR01014165    MBY26784.1    ABLF02039606    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02008636    ABLF02041863    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GGMR01014351    MBY26970.1    ABLF02015138    GBBI01004276    JAC14436.1    GGMS01006636    MBY75839.1    GGMR01017784    MBY30403.1    GGMR01002024    MBY14643.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    ABLF02035780    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GBBI01004410    JAC14302.1    GBBI01004408    JAC14304.1    GGMR01009860    MBY22479.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GGMR01003717    MBY16336.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    GGMR01008932    GGMR01010920    MBY21551.1    MBY23539.1    ABLF02041670    GBHO01028617    JAG14987.1    GDHC01014057    JAQ04572.1    GDHC01002235    JAQ16394.1    GBHO01037781    JAG05823.1    GGMR01011131    MBY23750.1    LBMM01009202    KMQ88311.1    GGMR01002421    MBY15040.1    GGMR01010723    MBY23342.1    GGMS01009443    MBY78646.1    GBHO01023090    JAG20514.1    GGMR01013370    MBY25989.1    GGMR01005823    MBY18442.1    ABLF02006784    ABLF02006304    ABLF02036268    GAMC01020552    JAB86003.1    GDHC01011948    JAQ06681.1    GDHC01019528    JAP99100.1    GEZM01066274    JAV68017.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMS01014951    MBY84154.1    ABLF02028417    ABLF02042407    ABLF02041614    GGMR01002187    MBY14806.1    ABLF02005251    ABLF02055296    LNIX01000016    OXA46198.1    ABLF02041650    ABLF02028666    ABLF02066713   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF09337   zf-H2C2
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR000477   RT_dom       
IPR017907   Znf_RING_CS       
IPR001995   Peptidase_A2_cat       
IPR015416   Znf_H2C2_histone_UAS-bd       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
877
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0418800000000003
Exp number, first 60 AAs:
0.03274
Total prob of N-in:
0.00193
outside
1  -  877
 
 

Population Genetic Test Statistics

Pi
155.032318
Theta
27.564411
Tajima's D
2.769517
CLR
131.961995
CSRT
0.968401579921004
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号