SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04054
Annotation
retroelement_polyprotein_[Glyptapanteles_flavicoxis]
Location in the cell
Nuclear   Reliability : 2.527
 

Sequence

CDS
ATGCCACATGTTAATCAAGTTCAGTGTATAAATCCAATTTTCGATAAACTGGATTGTGATCTCACAAATGAAGAAGATATCGCAAAATTACGCACCCTTCTAAACAAATATCAGCACCTGTTTATCAGAGGGTATCCAACAACTCGTGTCAAGACAGGTGAACTGGAAATCCGCCTGAAGAATCCAAACAAATATGTAGAACGAAGACCTTACAGGCTCAGTCCAATCGAACGAGAAAGGGTGCGAGCCATTGTGAAAGAGTTGATGGAGCATGGCATTATACGCGAAAGCAAGTCCCCATACTCCAGTCCCATCATCTTGGTGAAGAAGAAGAATGGTGACGATCGCATGTGCGTGGATTTCAGAGAACTTAACTCTAATACCTTACGGGACCATTACCCGCTGCCACTAATTTCAGACCAAATTGACCAATTGGCCAAGGGGCAATTCTTTACAACCTTTGACATGGCCGCAGGGTTTCACCAAATGCCTATTGCAGAATCATCAATTGAAAAGACAGCCTTTGTCACACCGGATGGGCTGTATGAATATACGACTATGCCATTTGGATTAAGTAATGCATGTTCAGTCTATCAACGATGCATCAACAGAGCTCTGAGCTCGTTAATAGGGAATGCAGCTCAAGTCTACGTCGACGACGTATTAAGCAGATGTAAAAATATCGCAGAAGGGCTGTCAAACATAGAACGTATTCTAATAGCACTACAAGATGCGGGCTTTTCCATTAATGCTGATAAATGCAGTTTTTTTAAGCGTTCAATCGAATATTTGGGTAACGTAGTATCTAATGGACAAGTCTGGCCAAGCCCACGGAAAATAGATGCTCTGGTAAAATCGCCTGTACCAACAACACCCAGACAAGTAAGACAATTTTGTGGATTGGCTGGCTACTTTAGAAAATTTATAGCAAACTTCTCACGCATAATGATACCACTATACGAGTTGACCAAATCAGGGGCTAAATGGGAGTGGGACGAGCGCCATGAGAAAGCAAGAGAGAATGTCATTCAGTGCTTAACATCAACTCCAGTACTAACACTATTCCAGGAGGAAGCACCTATTCAATTGTACACAGATGCAAGTAGTTTGGGATTCGGAGCAGTACTGGTACAAGTAATTGCGGGACGACAACATGCAGTTGCCTTTATGAGCATGAGAACTACTGAAACAGAAAGTCGCTATCACTCTTATGAATTAGAGACCTTGGCAGTAGTCCGAGCGATAAAACACTTCCGGCAGTATCTTTATGGACGTAAGTTTACAGTTATCACAGACTGTAATGCACTAAAAGCATCCAAACACAAAAAGGACTTACTCCCTAGAATCCACCGTTGGTGGGCATTTCTACAAAACTATAATTTTGAGGTTGAATACCGCAAGGGTCAACAGCTTCAACACGCAGACTACTTCAGTAGGAACCCAGTCGAACTCACAGTGAATATAATGACCAGAGATCTAGACTGGCTGAAAATTGAACAGCGACGTGATGAAACACTACGAGCTATAATGAATGGTATGAGTAATAACAATCCAAGCAACGGCTATATGCTAGAAAACAATGTCCTCAAGCGTATCGTACAAGATCCAACCTTCGGACACCGATACTGCACAGTGGTACCCAGGTCCTTTCAGTGGAGTTTAATAAACTCCTTCCACACCGCACTGAAACACCCTGGCTGGGAAAAGACGTTGCAGAAAATTAAGGACAGCCACTGGTTTGACAACATGAGCACGAAGGTACGAAAATTTGTTGACAATTGCGTGGTCTGCAGGACATCGAAAGGAGCATCTGGTGCGGTACAAGCTCAAATGCACCCGATTCAGAAACCGTCTGCTACTTTTCAAGTAATACACATGGATATAACAGGCAAGATGGGAACATCCAACGACCAACAGTATGTGATTATCACCATAGATGCTTTTACAAAATACGTGCTATTCTATTATGCAACTAACAAAAATCCACCCAGCACATTAGCTGCCCTAAAGCGTACGGTTCATCTATTCGGTACTCCTATCCAAATAATAGTAGACGGTGGAAGAGAGTTCCTCGGTGAATTCAAGACCTACTGCGATAGGGTAGGTATTGACATTCATGCTATAGCACCAGGAGTCAGCCGACCAAATGGACAAGTAGAACGCGTCGTAGCTACACTAAAAAATACTCTTACTATGATCAAGAATTATGAAACAGAAGAGTGGCACACAACGATTGCAGAACTTCAGCTAGCAATAAATTGCACTCCGCATCGTGTGACAGGCGTGGCTCCACTTACATTACTCACTCAGCGAAAGCATTGTGTTCCTCCAGAGCTACTCAATTTAGTAAATATTGACGAGCAGACTATTGATATTGAAGCACTCACTAACCATGTTCAACACAAGATGTCACAAAATGCAGAACAGGACAGGCAACGTTTCAATTCAAAAAAAGCCAGGATCCATCATTTCCAGCGTGGTGATTATGTGCTCATAAAAAATAATCCTCGTAATCAAACTTCGTTGGATCTCAAATTCAGCGAGCCATATGAGATAACAAGAATCCTGGACAACAACCGCTATTTAGTAAAAAAGGTGGTTGGTTCAGGGCGTTCAAGAAAAGTAGCTCATCATCAACTGCGTCGGGCACCGCAACCTGGAGACCAGATAGCCGTATCGGCGGAAGAAGACGACCCTCCAGCATCAGCCGATGAACCTATATGA
Protein
MPHVNQVQCINPIFDKLDCDLTNEEDIAKLRTLLNKYQHLFIRGYPTTRVKTGELEIRLKNPNKYVERRPYRLSPIERERVRAIVKELMEHGIIRESKSPYSSPIILVKKKNGDDRMCVDFRELNSNTLRDHYPLPLISDQIDQLAKGQFFTTFDMAAGFHQMPIAESSIEKTAFVTPDGLYEYTTMPFGLSNACSVYQRCINRALSSLIGNAAQVYVDDVLSRCKNIAEGLSNIERILIALQDAGFSINADKCSFFKRSIEYLGNVVSNGQVWPSPRKIDALVKSPVPTTPRQVRQFCGLAGYFRKFIANFSRIMIPLYELTKSGAKWEWDERHEKARENVIQCLTSTPVLTLFQEEAPIQLYTDASSLGFGAVLVQVIAGRQHAVAFMSMRTTETESRYHSYELETLAVVRAIKHFRQYLYGRKFTVITDCNALKASKHKKDLLPRIHRWWAFLQNYNFEVEYRKGQQLQHADYFSRNPVELTVNIMTRDLDWLKIEQRRDETLRAIMNGMSNNNPSNGYMLENNVLKRIVQDPTFGHRYCTVVPRSFQWSLINSFHTALKHPGWEKTLQKIKDSHWFDNMSTKVRKFVDNCVVCRTSKGASGAVQAQMHPIQKPSATFQVIHMDITGKMGTSNDQQYVIITIDAFTKYVLFYYATNKNPPSTLAALKRTVHLFGTPIQIIVDGGREFLGEFKTYCDRVGIDIHAIAPGVSRPNGQVERVVATLKNTLTMIKNYETEEWHTTIAELQLAINCTPHRVTGVAPLTLLTQRKHCVPPELLNLVNIDEQTIDIEALTNHVQHKMSQNAEQDRQRFNSKKARIHHFQRGDYVLIKNNPRNQTSLDLKFSEPYEITRILDNNRYLVKKVVGSGRSRKVAHHQLRRAPQPGDQIAVSAEEDDPPASADEPI

Summary

EMBL
EF710649    ACE75273.1    GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    + More
GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    GDHC01018907    JAP99721.1    GDHC01004980    JAQ13649.1    GBHO01030786    JAG12818.1    GDHC01012341    JAQ06288.1    GBHO01011083    GBHO01009497    JAG32521.1    JAG34107.1    GBHO01015604    JAG28000.1    X14037    CAA32198.1    KQ971345    EFA05054.2    GBHO01031154    JAG12450.1    GBYB01013920    JAG83687.1    LBMM01008871    KMQ88569.1    GEZM01007614    GEZM01007613    GEZM01007612    JAV95056.1    GEZM01007616    GEZM01007615    GEZM01007611    JAV95051.1    KQ971338    KYB27887.1    KYB27888.1    KQ460883    KPJ11409.1    GEGO01004299    JAR91105.1    RSAL01000274    RVE43148.1    GEZM01089268    GEZM01089261    JAV57577.1    GEZM01089269    GEZM01089265    JAV57567.1    KQ971339    KYB27733.1    ABLF02004401    ABLF02013544    ABLF02013550    GBHO01043544    GBHO01031946    GBHO01031931    GBHO01022910    GBHO01022909    GBHO01015498    GBHO01001135    GBHO01001106    JAG00060.1    JAG11658.1    JAG11673.1    JAG20694.1    JAG20695.1    JAG28106.1    JAG42469.1    JAG42498.1    GBHO01022918    GBHO01006165    GBHO01006163    GBHO01001110    JAG20686.1    JAG37439.1    JAG37441.1    JAG42494.1    GGMR01009949    MBY22568.1    GBHO01041008    GBHO01006162    GBHO01001134    GBHO01001105    JAG02596.1    JAG37442.1    JAG42470.1    JAG42499.1    ABLF02033943    ABLF02042737    GEZM01033083    JAV84424.1    LBMM01010976    KMQ87102.1    LBMM01005919    KMQ91095.1    GEZM01005427    JAV96179.1    GBBI01004551    JAC14161.1    GBBI01004550    JAC14162.1    KMQ91096.1    LBMM01011782    KMQ86633.1    ABLF02004526    ABLF02054969    GGMS01008442    MBY77645.1    KQ971370    KYB25609.1    KYB25610.1    IAAA01004057    LAA02040.1    IAAA01004058    LAA02042.1    IAAA01004056    LAA02037.1    GBBI01004477    JAC14235.1    GGMR01015682    MBY28301.1    ABLF02008401    ABLF02008404    ABLF02041876    GFXV01005120    MBW16925.1    GEZM01034557    JAV83728.1    GEHC01000930    JAV46715.1    GGMR01003388    MBY16007.1    GBXI01005773    JAD08519.1    GGMR01005091    MBY17710.1    ABLF02014660    ABLF02042774    GEHC01000888    JAV46757.1    GAKP01001563    JAC57389.1    KA649989    AFP64618.1    ABLF02017401    GFTR01008753    JAW07673.1    GEZM01051217    GEZM01051215    JAV75083.1    GAKP01019383    JAC39569.1    ABLF02022032    NWSH01002797    PCG67520.1    GAKP01016235    JAC42717.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    X95908    CAA65152.1    GEHC01000876    JAV46769.1    GGMR01016004    MBY28623.1    GAMC01020207    JAB86348.1    LRGB01002748    KZS06406.1    GAKP01014483    JAC44469.1    GBXI01015151    JAC99140.1    GGFM01003105    MBW23856.1    GAMC01015907    JAB90648.1    GAMC01007326    JAB99229.1    GBBI01004549    JAC14163.1    ABLF02005127    ABLF02005129    ABLF02007401    GGMS01012726    MBY81929.1    ABLF02005846    GGMR01014665    MBY27284.1    GBBI01004613    JAC14099.1    GGMR01000717    MBY13336.1    GEHC01000891    JAV46754.1    GAKP01008942    JAC50010.1    GGFL01001689    MBW65867.1   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00098   zf-CCHC
PF00078   RVT_1
PF17917   RT_RNaseH
PF00077   RVP
PF14392   zf-CCHC_4
PF03732   Retrotrans_gag
PF02037   SAP
PF07530   PRE_C2HC
PF03273   Baculo_gp64
PF13873   Myb_DNA-bind_5
PF09668   Asp_protease
PF12384   Peptidase_A2B
PF16064   DUF4806
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR034122   Retropepsin-like_bacterial       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR005162   Retrotrans_gag_dom       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR004955   Baculovirus_Gp64       
IPR006579   Pre_C2HC_dom       
IPR028002   Myb_DNA-bind_5       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR024650   Peptidase_A2B       
IPR032071   DUF4806       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=2.54414e-69,     Score=669

Ontologies

Topology

Length:
907
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01823
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00034
outside
1  -  907
 
 

Population Genetic Test Statistics

Pi
377.617507
Theta
220.41816
Tajima's D
3.478683
CLR
28.534411
CSRT
0.993150342482876
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号