SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04051  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010289
Annotation
UDP-glucosyltransferase_precursor_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.677
 

Sequence

CDS
ATGATGATACGAAGACTCACAATTGCAATAGCTGTTTGCTTCTGTTTGGGTGTCGATGCGTACAAGATACTGACAGTGTTTCCTGTGCCGGGAAGAAGCCATGGAATCCTTGGAGATGCTGTAGTCAGACATCTATTGGAAGCTGGCCACGAGGTGACACACATAACGCCGTTTCCGAAGAAGGAGCCGCCGCCGAATTTGGTTCAAATAGACGTTGCGGCAAACAAGGCGGCGTTTAATGAGGACTACATAGATATAAAGGCCTTGATGACAAAGGAATTTAACCTTAAAGACAAGAATGTACTATTTTCATTGATGAACAACATAAGCAGCTCCACTATTCTGAACGAGAATGTTCAGAGGCTACTGAGGGATCAGAGTCGTGAGCAGTTCGACGTGATCATAGCCGAATGGATGTTCAGTGATCTATACGCTTCATTCCACGCAGTTCTGGATTGCCCTTTGATTTGGTTCTCAACGATCGAACCTCATTGGATGGTTCTCAGATTGATCGATGAATATCCAAACCCAGCGTACACCTCACACTTTCAGGACAGCTTCGAAGTACCATTTACGTTCGTGGAAAGGATGTCTGTACTATCATCACAACTTACGTGGAGCTTAAGTTTAAATACGTGGGTATACGATCTTGAAAAGTATATATACGACAACAATATTGCTCCTATAATAAAAAAGAACGGTAAACCAGTACCTAACTATGACGAAGTGAGATACAATGGATCTTTACTGCTCGGTAATTCTCATGTCTCGTTGGGAGATGCGATTAAGGTACCGATTAATTACAAAGCCATTGGTGGTTATCATATTGATGGAAAAGTAAAAGAATTGCCACCGGATCTACAAAAAATAATGAACGAATCAAAACACGGCGTCATTTACTTCAGTATGGGCTCGAATTTGAAGAGCAAAGATCTACCGAAGGAGATTAAAGAGGGACTACTGAAAATGTTTAGCCAATTAAAACAGACGGTTTTATGGAAGTTTGAGGAAAACTTATCACCTTTACCGGAAAACGTTCATTTATTGAAATGGGCACCTCAACAGAGTATCCTGGCACACCCGAACTGCATTCTTTTCATAACTCACGGAGGTCTTCTATCGACAACAGAGGCTGTACATTTTGGTAAGCCCATCATCGGCATACCGGTCTTTGCCGATCAGTTTGGTAACGTCAACAGAGCAGTCCAGAAAGGTATTGCGAGGAGAGTGGATTTATCGTTCACGATGGTCCGTGATCTGGAGGAAGCTGTTGCGGAAATGATCAATAATTCTAGGTACATAGAAAAAATAAAGGAGTTATCTTTGATATATCACGATCGTCCGGTGTCTCCGGGTGCTGAGCTGGTCCACTGGGTGGAGCACGTCGTCAAGACTAAAGGAGCTCTCCATCTGCGATCACCAGCACTGCACGTGCCTTTCTACCAGAAGCTGTACTTAGATCTGCTCGCTATTGTTCTGGTCACTTTATTCTCGTTTGTATTAACATGTGATTGTTATAAAATTTTGATTGTATTTACGACTCCTATGAAAAGTCATAATATACTTGGAGAGGCTGCAGCGGAGTTATTGTTGAATGCTGGCCACGAGGTCACATACGTGACGCCCTTCCCAAAAGAATCTGTTCCCGATAAGATGCGCCAGGTAGATGTAACTTACATCGGTAAAATAGGTTTGTTTGATTTAAAGGGGTATCTTAAAAATGACACTGTTAAACCAATGTCTCTACGTAAAATATCATACTTCATGCATGACGTGAACGTAAAAGCCATACAGAATGAGAATCTACAGCAACTTTTAAACGACCCTAGTCAACGATTTGACGCAGTCATCGTCGATTGGTTGTTCAGTGAAATTTTCGTAGGGCTAGCATCATTGTATGATTGTCCATTGATTTGGATGTCGACTATGGATCCGCACTGGCAAATCTTGAGACTGGTAGACGAGATGCCCAATCCTGTATTTCTGGGCCGTTGTTTCCTTGATAGAATTGTGCCATTTCGTTTTTGGGAACGGACCCAAGAGTTACTTTATCAGATCTCATCGTTGTTCTTTAAGGATATAGAGTTCTTTAGTGAAGAGGATGCTGCGTTTAAAAGATTGCTCGGTCCCGTATTCGCTAGAAAGAAGAAACCCCTACCTTCATTTAATGCAGTGAGATACAATGCTTCGTTAGTGCTGAGTAATTCACACCATTCAATAGGTTACCCTGTAAAACTGCCGCCCAATTTTATATCAATCGGAGGTTTTTTTATCGATGACAAGAAACAGCGTCTGTCTTTGGATTTACAAACAATAATGGACAATGCCAAGCACGGTGTCATATTATTTAGCTTAGGGAGCAATTTGAAAAGTAAGGATATGCCGGAACATCTCGTTCGAAGCCTTTTAAATGTATTCAGCGAACTGAAACAAATAGTTATCTGGAAGGTCGAAGAACAAATAGCTGATCTACCTCAAAATGTTCATGTTTTGAAATGGTTGCCGCAGCAGAGTATTTTAGCTCATTCAAACTGTATTCTCTTCATTACCCACGGAGGATTGTTGTCGATTACCGAAGCATATCATCACGGGGTACCTTTAATAGGAATTCCGGTGTTCGCTGATCAATTTAAGAACGTTAATCTGGTTTCAAAGAAGGGCTTCGCGAAGAAAGTTGATCTCACCTACAATTTGCCGGGTGACTTAAAACATGCAATCAATGAAATTTTACATAACAAACGGTATCTTGAACAAGCCAAGCTGTGGTCAGAAATATTCCACCATAGATCAGTAAATCCTAGAAAAGAACTGGTACACTGGGTCGAACATGTTATTCACACTCGTGGAGCCACTTATCTACGATCTCCGGCATTGGACGTGCCTTTATACCAAAAGATGTATTTGGACCTTTTGGGCCTAGTTATGCTAGTTTTGATGGCATTAACATTCTTAATTAAGAATGTGATAAAATTATTTATGGTTCGGGGTATAGTACACGAGAAGATGGAATGA
Protein
MMIRRLTIAIAVCFCLGVDAYKILTVFPVPGRSHGILGDAVVRHLLEAGHEVTHITPFPKKEPPPNLVQIDVAANKAAFNEDYIDIKALMTKEFNLKDKNVLFSLMNNISSSTILNENVQRLLRDQSREQFDVIIAEWMFSDLYASFHAVLDCPLIWFSTIEPHWMVLRLIDEYPNPAYTSHFQDSFEVPFTFVERMSVLSSQLTWSLSLNTWVYDLEKYIYDNNIAPIIKKNGKPVPNYDEVRYNGSLLLGNSHVSLGDAIKVPINYKAIGGYHIDGKVKELPPDLQKIMNESKHGVIYFSMGSNLKSKDLPKEIKEGLLKMFSQLKQTVLWKFEENLSPLPENVHLLKWAPQQSILAHPNCILFITHGGLLSTTEAVHFGKPIIGIPVFADQFGNVNRAVQKGIARRVDLSFTMVRDLEEAVAEMINNSRYIEKIKELSLIYHDRPVSPGAELVHWVEHVVKTKGALHLRSPALHVPFYQKLYLDLLAIVLVTLFSFVLTCDCYKILIVFTTPMKSHNILGEAAAELLLNAGHEVTYVTPFPKESVPDKMRQVDVTYIGKIGLFDLKGYLKNDTVKPMSLRKISYFMHDVNVKAIQNENLQQLLNDPSQRFDAVIVDWLFSEIFVGLASLYDCPLIWMSTMDPHWQILRLVDEMPNPVFLGRCFLDRIVPFRFWERTQELLYQISSLFFKDIEFFSEEDAAFKRLLGPVFARKKKPLPSFNAVRYNASLVLSNSHHSIGYPVKLPPNFISIGGFFIDDKKQRLSLDLQTIMDNAKHGVILFSLGSNLKSKDMPEHLVRSLLNVFSELKQIVIWKVEEQIADLPQNVHVLKWLPQQSILAHSNCILFITHGGLLSITEAYHHGVPLIGIPVFADQFKNVNLVSKKGFAKKVDLTYNLPGDLKHAINEILHNKRYLEQAKLWSEIFHHRSVNPRKELVHWVEHVIHTRGATYLRSPALDVPLYQKMYLDLLGLVMLVLMALTFLIKNVIKLFMVRGIVHEKME

Summary

Similarity
Belongs to the UDP-glycosyltransferase family.
Pfam
PF00201   UDPGT
Interpro
IPR035595   UDP_glycos_trans_CS        + More
IPR002213   UDP_glucos_trans       
PDB
2O6L     E-value=2.32639e-24,     Score=282

Ontologies

Topology

SignalP
Position:   1 - 20,         Likelihood:  0.987682
 
 
Length:
1003
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
63.29305
Exp number, first 60 AAs:
14.80966
Total prob of N-in:
0.66300
POSSIBLE N-term signal
sequence
inside
1  -  6
TMhelix
7  -  29
outside
30  -  965
TMhelix
966  -  985
inside
986  -  1003
 
 

Population Genetic Test Statistics

Pi
200.354769
Theta
156.257387
Tajima's D
1.151052
CLR
0.197144
CSRT
0.700064996750163
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号