SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04047
Pre Gene Modal
BGIBMGA010286
Annotation
PREDICTED:_UDP-glucosyltransferase_isoform_X1_[Bombyx_mori]
Full name
UDP-glucuronosyltransferase      
Location in the cell
Peroxisomal   Reliability : 1.101 PlasmaMembrane   Reliability : 1.288
 

Sequence

CDS
ATGTTCAAGCTCACATTCCTGGTCTGCTGTATCCTGGCTACTCAATCCGTTTCTGATGCCTATAAAATCCTGGTGGTGTTCCCTATGCCCGGCAAAAGCCACAGTATCCTGGGGTACAGTGTCGTGAAGCATCTCCTAAAAGCTGGTCATGAGGTGACATATGTAACTCCTTTCGTTGAGGACAATCACCACCCGAACCTGACTCAAGTTGATGTTAGCAGCAATATGCGTTTGATACCTAAGGGCGGATTAGACTTGAAGAGAGTTCTAGACAAAGAGGTAAACGTAATAGACAACGGGTTTATGTTTTATTTCATGAAACAAATACAGGAAGCTACTCTGGAGCATGAGCAAGTTAAAAAGTTGCTCGAGGACCCGAATAAGACCTTCGATATTGTTATCGTTGAGTGGATGTATTGCGAATTGGGTGCTAGTTATGCTGCGGTATTCGACGTTCCACTTATATGGTTGTCGACCATGGAGCCTCACTGGTTGGTGACGAGGCTCATCGATGGGAATCTAAATCCAGCCTACAACGGGGATTCTATGTCTTCCAGTATTCCTCCATTTACGTTCTTGCAAAGAGTCAAGGAACTCTGGATTCAAATTCACACTAGTTTTATATTGCTCAATGATGATCAAGAGAGATCGTACGACAGATTAGTGAGGCCACTCATTGAAAAAAAAGGTAGGAAGGCGCCTTCGTTTGAGGATTTGAAGTTCAATGCTTCTTTAGTACTCGGAAATTCGCATGTATCTTTGGGAGAAGCAACCGGAACTCCGCAGAGCTACAAACCCATCGCTGGATACCATATAGAAGAAGTTGTGAAACCTTTACCAGCTGACCTCAAAGAGATAATGGAAAACGCAAAGCACGGTGTCATCTATTTCAGTATGGGATCAAATTTGAAGAGTACAGAAATGCCAGATGAGATGAAGCAGAATCTTGTAAAAATGTTCGGTGAATTGAAACAGACTATTATCTGGAAGTTTGAAGAAGACTTCCCGAATCTCCCGAAAAACGTCCACATCGTAAATTGGGCACCACAACCAAGTATTTTATCTCATCCTAATTGCGTGTTATTCATCACACACGGAGGTCTACTTTCAACGACCGAAAGCGTACATTTTGGAGTGCCAATTGTGGGAATACCAGTTTTTGGTGATCAATTTATCAATGTCCAAAGGGCTGTTAAAAGGGGATTCGCGAAGAAAGTTGATTTCTCGTACTCAATGGTCGGAGAACTTAAGGTCGCTATTCAAGAAATTTTAAGTGACTCCAGCTACAGAACCAGAATTAAGGAGCTATCGTTGATATATCACGATCGTCCGGTGTCTCCTGGTGCCGAGCTGGTGCATTGGGTTGAGCACGTGGCCAGGACAAGAGGAGCTCTCCATCTGCGCTCACCAGCACTGCACGTGCCTTTCTACCAGAAGTTGTACTTAGATCTATTGGCCGTTGTATTAATAATTTCGCTAATCTTTTATAGAAAAATTTGTTTGATAAAAAATCTTTTACTGTCATTTTTTCAAACAAATGAAATCAAGAAGAAAAAGAAGAGGAATTAA
Protein
MFKLTFLVCCILATQSVSDAYKILVVFPMPGKSHSILGYSVVKHLLKAGHEVTYVTPFVEDNHHPNLTQVDVSSNMRLIPKGGLDLKRVLDKEVNVIDNGFMFYFMKQIQEATLEHEQVKKLLEDPNKTFDIVIVEWMYCELGASYAAVFDVPLIWLSTMEPHWLVTRLIDGNLNPAYNGDSMSSSIPPFTFLQRVKELWIQIHTSFILLNDDQERSYDRLVRPLIEKKGRKAPSFEDLKFNASLVLGNSHVSLGEATGTPQSYKPIAGYHIEEVVKPLPADLKEIMENAKHGVIYFSMGSNLKSTEMPDEMKQNLVKMFGELKQTIIWKFEEDFPNLPKNVHIVNWAPQPSILSHPNCVLFITHGGLLSTTESVHFGVPIVGIPVFGDQFINVQRAVKRGFAKKVDFSYSMVGELKVAIQEILSDSSYRTRIKELSLIYHDRPVSPGAELVHWVEHVARTRGALHLRSPALHVPFYQKLYLDLLAVVLIISLIFYRKICLIKNLLLSFFQTNEIKKKKKRN

Summary

Catalytic Activity
glucuronate acceptor + UDP-alpha-D-glucuronate = acceptor beta-D-glucuronoside + H(+) + UDP
Similarity
Belongs to the UDP-glycosyltransferase family.
Feature
chain  UDP-glucuronosyltransferase
EC Number
2.4.1.17
EMBL
JQ070255    AEW43171.1    AB539963    BAJ08153.1    JQ070253    AEW43169.1    + More
JQ070252    AB539964    AEW43168.1    BAJ08154.1    ODYU01004685    SOQ44830.1    KZ149930    PZC77368.1    NWSH01000282    PCG77781.1    KF777115    AHY99686.1    ODYU01009829    SOQ54516.1    JQ070214    AEW43130.1    PCG77782.1    JQ070254    AEW43170.1    AB539967    BAJ08157.1    BABH01011785    BABH01011786    BABH01011787    KU680294    ANI22000.1    PZC77366.1    JQ070207    AEW43123.1    KU680295    ANI22001.1    PZC77367.1    AF324465    AAL55994.1    KU680303    ANI22009.1    KU214507    AMK97473.1    RSAL01000210    RVE44216.1    JQ070208    AEW43124.1    JQ070247    AEW43163.1    KY202932    AUC64276.1    KF777116    AHY99687.1    KU680304    ANI22010.1    KY202937    AUC64281.1    JTDY01003683    KOB69154.1    KF777113    AHY99684.1    KU680296    ANI22002.1    GEYN01000076    JAV02053.1    AB539965    BAJ08155.1    ODYU01012744    SOQ59206.1    JQ070210    AEW43126.1    ODYU01005852    SOQ47145.1    RVE44215.1    FJ373022    ACQ66003.1    GEYN01000085    JAV02044.1    PZC77369.1    NWSH01003535    PCG66153.1    KU680302    ANI22008.1    KU680297    ANI22003.1    KQ460075    KPJ17950.1    ODYU01000116    SOQ34342.1    JQ070213    AEW43129.1    KU214508    AMK97474.1    KQ459582    KPI98793.1    JQ070256    AB539969    AEW43172.1    BAJ08159.1    KPI98725.1    KPJ17977.1    JQ070257    AEW43173.1    AB539966    BAJ08156.1    NWSH01002698    PCG67661.1    KU680298    ANI22004.1    JQ070250    AEW43166.1    JQ070212    AEW43128.1    PZC77370.1    PZC77371.1    AK402777    BAM19379.1    RSAL01000067    RVE49308.1    KQ459356    KPJ01283.1    KU680300    ANI22006.1    KQ460597    KPJ13897.1    RVE49310.1    NWSH01003818    PCG65793.1    JQ070251    AEW43167.1    AGBW02007992    OWR54346.1    ODYU01010264    SOQ55252.1    KU680301    ANI22007.1    AK404892    BAM20357.1    KY202946    AUC64290.1    RVE49311.1    GEYN01000100    JAV02029.1    JQ070209    AEW43125.1    KY202925    AUC64269.1    KF777114    AHY99685.1    KU680299    ANI22005.1    JQ070258    AB539968    AEW43174.1    BAJ08158.1    NWSH01003979    PCG65597.1    SOQ44829.1    KPJ13896.1    KPI98794.1    JQ070249    AEW43165.1    JQ070211    AEW43127.1    AGBW02009118    OWR51610.1    ODYU01006413    SOQ48233.1    JQ070248    AEW43164.1    PZC77372.1    JTDY01003050    KOB70242.1    AGBW02012922    OWR44215.1    GEYN01000087    JAV02042.1   
Pfam
PF00201   UDPGT
Interpro
IPR035595   UDP_glycos_trans_CS        + More
IPR002213   UDP_glucos_trans       
PDB
2O6L     E-value=1.2326e-25,     Score=290

Ontologies

Topology

Subcellular location
Membrane  
SignalP
Position:   1 - 20,         Likelihood:  0.993325
 
 
Length:
522
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.52149
Exp number, first 60 AAs:
0.61798
Total prob of N-in:
0.03002
outside
1  -  473
TMhelix
474  -  496
inside
497  -  522
 
 

Population Genetic Test Statistics

Pi
25.273633
Theta
23.402756
Tajima's D
0.698552
CLR
120.424005
CSRT
0.581270936453177
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号