SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04025
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.478
 

Sequence

CDS
ATGCCGCCTCTCGTACGCGCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCATCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGAGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGACGCGATCGATAGCCTACAACCACGAAAAGCTCCAGGCTCCGACGGCATCCGCAACCGCGCGCTAAAATTGTTACCAGCCCAACTAATAACGATGTTGGCCACCATTTTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCTGACGTTATCGGCATACACAAGCCGGGCAAACCAAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCAGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTTACCGCGAACAAAATTCTTATAGACGAGCAGTTTAGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATACTACTAGGGCTGAATAGGCGGAAACCCATCCCGACAGGAGCCCTCTTCTTCGATATAGCGAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTACCAGACAGACTCGTGCTAATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATACCGAGTCGAGGGAACGCGTTCCCGCCCCCGTCACGTCACAGCCAGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAATGATATACCCCGATCTCCGGAGACCCATCTGGCGGTCTTCGCCGATGACACCGCCATCTATTACTCGTGTAGGCGTTGCTTCATCGAAGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAAGCCCACGAAAAGCACAGCGGTGCTCTTCAGAAGGGGTCGCCCTCCGAACACCACGCTGA
Protein
MPPLVRASGQPPAYDDDDKAELLADALQEQCITSTQHADPEHTELVDREVERRASLPPSDALPPITTSEVKDAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVTANKILIDEQFRFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTARVPQGSALSPLLFSLYINDIPRSPETHLAVFADDTAIYYSCRRCFIEDFRPQLPPWDSGSGSGASTSSPRKAQRCSSEGVALRTPR

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973412    EFA12510.2    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GEZM01008457    JAV94772.1    GGMS01008766    MBY77969.1    GGMS01000737    MBY69940.1    KQ973073    KXZ75680.1    ABLF02024191    ABLF02066493    KQ973213    KXZ75606.1    GGMS01000625    MBY69828.1    GALX01005359    JAB63107.1    GGMR01006408    MBY19027.1    ABLF02003961    ABLF02059872    ABLF02014862    ABLF02014866    ABLF02061908    KK855204    PTY21424.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMS01006359    MBY75562.1    GGMR01002322    MBY14941.1    JXUM01155316    KQ572171    KXJ68070.1    GFXV01007093    MBW18898.1    GGMS01017365    MBY86568.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    GGMR01003407    MBY16026.1    GGMR01018716    MBY31335.1    GECU01013097    JAS94609.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02016634    GBBI01004395    JAC14317.1    GGMS01005381    MBY74584.1    GGMR01013409    MBY26028.1    NEVH01006736    PNF36716.1    ABLF02003242    ABLF02006260    ABLF02042516    GGMR01012305    MBY24924.1    NEVH01020071    PNF21969.1    NEVH01003017    PNF40781.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01023961    PNF17613.1    GGMR01000676    MBY13295.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    NEVH01010546    PNF32261.1    NEVH01019080    PNF22876.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    GBYB01008290    JAG78057.1    NEVH01005938    PNF38077.1    NEVH01000280    PNF43672.1    ABLF02005298    ABLF02018860    NEVH01001355    PNF42855.1    GGMS01002955    MBY72158.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02034467    NEVH01019964    PNF22161.1    GGMR01000086    MBY12705.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF13358   DDE_3
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR038717   Tc1-like_DDE_dom       
IPR001878   Znf_CCHC       
IPR018289   MULE_transposase_dom       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00610411,     Score=93

Ontologies

Topology

Length:
356
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.41535
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03280
outside
1  -  356
 
 

Population Genetic Test Statistics

Pi
12.012877
Theta
4.411884
Tajima's D
3.36615
CLR
0.169032
CSRT
0.993400329983501
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号