SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04015
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.287 Nuclear   Reliability : 1.079
 

Sequence

CDS
ATGACGCGGAGGCAGTTTGTAATCGGAACTACTCGAGATGAAACAGCGAACGGATCACCTAAAGCAAAGCGGAAGAAACGAATTACGAATTTTGGAACATTATCATGGTTCTGCCCTAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCTGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCAATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGCGAGACGCGCAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATTTCGCCCAAGCCCTGGCCCTCTAA
Protein
MTRRQFVIGTTRDETANGSPKAKRKKRITNFGTLSWFCPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAELTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADFAQALAL

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
212
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0538600000000001
Exp number, first 60 AAs:
0.04485
Total prob of N-in:
0.17267
outside
1  -  212
 
 

Population Genetic Test Statistics

Pi
139.995176
Theta
72.610485
Tajima's D
1.799437
CLR
0.042221
CSRT
0.851557422128894
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号