SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03967
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.368
 

Sequence

CDS
ATGATGATCCTGTTCTTCAAAAAAGGTGACAAAACCTTATTGAAGAACTATAGGCCCATAGCACTGCTGAGCCATATCTACAAGCTGTTCTCGAGAGTCATCACGAAGCGTCTCGAACGCAGGTTTGATGACTTCCAGCCTACCGAACAAGCCGGGTTCCGAAAAGGCTACAGTACCATAGACCACATACATACGCTGCGGCAGATTGTACAGAAGACCGAAGAGTACAATCGGCCATTATGCTTAGCGTTTGTGGACTATGAGAAAGCCTTTGATTCCGTCGAAACTTGGGCGGTCCTTAGATCTCTCCAGCGGTGCCGTATTGACCACCGGTACATCGAAGTATTGAAGTGTTTGTATAATAACGCCACCATGTCAGTCCGAGTACAGGAGCATTGCACGAAGGAAATCCCTGTAAAGAGAGGAGTGAGACAGGGAGATGTGATATCTCCGAAACTGTTTATCACTGCTCTGGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGACTTGGCATCAATATTAACGGCGAATACATCACTCATCTTCGGTTTGCCGATGACATCGTGGTCATGGCAGAGTCGCTGGAAGATTTAGGGCGTATGCTCGGTGACCTCAGTAGGGTTTCTCAACAAGTGGGTCTTAAAATGAACATGGATAAAACAAAAATCATGTACAATGTCCATGTTGCACCCACCATAGTTACTGTTGGGAGCTCTACTCTTGAAGTTGTTGACGAATATATATACCTAGGACAGGCAGTCCGATTAGGTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGCTGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGCCTTAAGACAAAGGCGTACAACCAATGTGTGTTACCAGTGATGACTTACGGCTCTGAGACGTGGTGCTTCACTAGGGATCTTTTTAGAAGGCTCAAAGTCACGCAGCGAGCTATGGAGAGGGCTATGCTCGGCATTTCTCTACGGGATCGAATCCGAAATGAGGAGATCCGTAGAAGAACGAAGGTTGCTGACATAGCCCGTAGAATTAGTGAACTGAAGTGGCAATGGGCCGGCCACATAGCACGAAGAGAGGACGGTCGATGGGGCAGAAAGATCCTGGAGTGGCGACCACGTACTGGCAAGCGCAGTGTGGGACGGCCACCTACTAGATGGACCGACGACCTAGTAAAAAGCGCTGGGTCTCGTTGGATGCAGGTGGCAATGAACCGGTCGCACTGGAAATCTATTGGAGAGGCCTATGTTCAGCAGTGGACGGCGATAGGCTGA
Protein
MMILFFKKGDKTLLKNYRPIALLSHIYKLFSRVITKRLERRFDDFQPTEQAGFRKGYSTIDHIHTLRQIVQKTEEYNRPLCLAFVDYEKAFDSVETWAVLRSLQRCRIDHRYIEVLKCLYNNATMSVRVQEHCTKEIPVKRGVRQGDVISPKLFITALEDSFKLLEWQGLGININGEYITHLRFADDIVVMAESLEDLGRMLGDLSRVSQQVGLKMNMDKTKIMYNVHVAPTIVTVGSSTLEVVDEYIYLGQAVRLGRSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKAYNQCVLPVMTYGSETWCFTRDLFRRLKVTQRAMERAMLGISLRDRIRNEEIRRRTKVADIARRISELKWQWAGHIARREDGRWGRKILEWRPRTGKRSVGRPPTRWTDDLVKSAGSRWMQVAMNRSHWKSIGEAYVQQWTAIG

Summary

EMBL
FJ265543    ADI61811.1    FJ265544    ADI61812.1    FJ265549    ADI61817.1    + More
KZ150072    PZC74016.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    RSAL01002362    RVE40503.1    FJ265542    ADI61810.1    FJ265551    ADI61819.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    RSAL01002130    RVE40575.1    EF113399    EF113400    ABO45233.1    AAGJ04144474    MRZV01002136    PIK34564.1    KZ149985    PZC75698.1    GFAC01005640    JAT93548.1    AAGJ04050748    MRZV01000899    PIK42833.1    FJ265562    ADI61830.1    KZ150485    PZC70710.1    KZ150108    PZC73382.1    KZ150317    PZC71439.1    ODYU01004982    SOQ45402.1    FJ265561    ADI61829.1    FJ265564    ADI61832.1    FJ265563    ADI61831.1    GBBM01001358    JAC34060.1    GBBI01004876    JAC13836.1    JARK01001434    EYC02684.1    RSAL01000016    RVE53061.1    GBGD01000453    JAC88436.1    GBBI01004877    JAC13835.1    JARK01000347    EYC38051.1    GDKW01001596    JAI54999.1    JARK01001639    EYB85201.1    JARK01001389    EYC11015.1    JARK01000460    EYC36749.1    JARK01001621    EYB86109.1    JARK01001364    EYC18031.1    KZ149907    PZC78256.1    JARK01001626    EYB85833.1    JARK01001340    EYC30828.1    JARK01001423    EYC04578.1    JARK01001438    EYC02012.1    JARK01001344    EYC28218.1    JARK01001349    EYC24735.1    JARK01001361    EYC19034.1    JARK01001346    EYC26784.1    JARK01000732    EYC35149.1    GFAA01001426    JAU02009.1    ODYU01004088    SOQ43598.1    JARK01001517    EYB93530.1    JARK01001370    EYC16151.1    JARK01001655    EYB84321.1    JARK01001362    EYC18843.1    JARK01001568    EYB89432.1    EYC18844.1    JARK01001343    EYC28635.1    JARK01001376    EYC14422.1    JARK01001351    EYC23395.1    EYC31295.1    JARK01001677    EYB83168.1    EYB83167.1    JARK01001378    EYC13977.1    JARK01001341    EYC30223.1    JARK01001500    EYB95040.1    EYC28825.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001543    EYB91354.1    EYB91355.1    JARK01001406    EYC07496.1    EYC29807.1    JARK01001630    EYB85641.1    JARK01001565    EYB89683.1    JARK01001354    EYC21986.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    JARK01001711    EYB81734.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001464    EYB98786.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    JARK01001636    EYB85342.1    JARK01000063    EYC44387.1    EYB98081.1    EYC40601.1    EYC31302.1    JARK01001365    EYC18010.1    EYC33297.1    JARK01001531    EYB92324.1    EYC18009.1    EYB85344.1    EYC10874.1    JARK01001432    EYC03125.1    JARK01001730    EYB81048.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001359    EYC20046.1    EYC26445.1    JARK01001581    EYB88505.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01826   TIL
PF13855   LRR_8
PF10323   7TM_GPCR_Srv
PF01549   ShK
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR019426   7TM_GPCR_serpentine_rcpt_Srv       
IPR017452   GPCR_Rhodpsn_7TM       
IPR003582   ShKT_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
Gene 3D
PDB
5HHL     E-value=1.67282e-05,     Score=116

Ontologies

Topology

Length:
438
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0846
Exp number, first 60 AAs:
0.03958
Total prob of N-in:
0.00549
outside
1  -  438
 
 

Population Genetic Test Statistics

Pi
299.986955
Theta
203.45649
Tajima's D
1.517619
CLR
87.166168
CSRT
0.790460476976151
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号