SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03905
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.991 Nuclear   Reliability : 1.504
 

Sequence

CDS
ATGGAGGTCGACCTTTCCCCCGCCGCCGCGACTGATGGATTCACAGTAGTCCAAAAAGGTAAAAAGCGCGCTGCGGAGGCCCGAGCTCCCGCGGTCGCTAAAGTAAGCAAAGCCGCGAACGCGTCGCGTCCCCGCCCTCCAACCCCCGTCGCTCCCGCTGTCCGTGCCACACCGTCGCCGCGTCCAGTGGCACAACCTAAAACTCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGACCGAGTTTCCCTGGCCCTTAAGGCCAAAAATATTAATTTTGTCAGCGCCCGTAATCTCGCCAACGGGATTCAAATAAAAGTAACGACACCCGACGAACATAGGGCCCTCTCAAGTTACCTCCGAAAGGAGCGTATAAGCTTCCACACTTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTCATACGTGGAATCCCGAAGGAGCTAGATGCCGATCTCGTCAAGGCTGATCTGATAGAACAAGGCCTACCAGTAAATTCCGTGCACCGCATGCACACCGGCCGCGGTAGGGAGCCATACAATATGGTTCTAGTCGCCCTCCAGCCTACCCCCGAGGTGCAGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAATATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCTGCGCTCACTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTGGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGATATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCAATTCCGTTCCCGTCATGAGGACTGTGGTGGATTGGCACACGCTGGGCATTAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCAACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTGCGATGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGTGGAAAATCGTACTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGATCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAGCTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGATGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTTGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGATTTGATCAAAGACCTACGTCCTCGCAAAGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCATCCAACTCATCGTGATGTTAGCATCTATCTTCAATGCCGCTATGGCTAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGAACGTTATCGGCATACACAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTGGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCATCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTCGTGGGACTTAACCGACCAAAACCGATCTACACGGGAGCCCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGTCTCGTGCTCATCATACGGGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAG
Protein
MEVDLSPAAATDGFTVVQKGKKRAAEARAPAVAKVSKAANASRPRPPTPVAPAVRATPSPRPVAQPKTQTPPPVILQEKAAWDRVSLALKAKNINFVSARNLANGIQIKVTTPDEHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDADLVKADLIEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEVQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALTNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPNSVPVMRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLCDDIRELLRAKNASIRAYDRYPTVENRTRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVAMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPLDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPIQLIVMLASIFNAAMANCIFPAVWKEANVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFISSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGALFFDVAKAFDKVWHNVSCSSYGTSCLTALFDIE

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
AB055391    BAB21761.1    U07847    AAA17752.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    KK115285    KFM64681.1    KK119261    KFM75202.1    GBBI01004395    JAC14317.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02042385    GGMS01006359    MBY75562.1    GGMR01018716    MBY31335.1    GGMR01015412    MBY28031.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01004661    MBY17280.1    GGMR01016297    MBY28916.1    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    KK118005    KFM71947.1    GGMR01000226    MBY12845.1    NEVH01006736    PNF36716.1    ABLF02034467    KK113281    KFM59799.1    GEDC01029594    JAS07704.1    ABLF02007779    ABLF02007782    ABLF02050375    NEVH01021205    PNF19912.1    GFTR01008271    JAW08155.1    GFTR01008261    JAW08165.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    ABLF02040174    ABLF02040183    ABLF02055266    NEVH01009134    PNF33528.1    GGMR01002322    MBY14941.1    NEVH01005277    PNF39135.1    ABLF02023911    GGMS01002992    MBY72195.1    ABLF02024246    GGMR01012443    MBY25062.1    GFTR01008251    JAW08175.1    GFTR01008257    JAW08169.1    NEVH01023280    PNF18085.1    GFTR01007929    JAW08497.1    GFTR01008256    JAW08170.1    GFXV01002840    MBW14645.1    GBBI01003810    JAC14902.1    GGMS01002786    MBY71989.1    GBBI01004571    JAC14141.1    GFTR01008260    JAW08166.1    GEZM01084970    JAV60359.1    ABLF02041861    GGMR01013409    MBY26028.1    GGFL01004957    MBW69135.1    GEZM01084969    JAV60363.1    GGMS01006655    MBY75858.1    NNAY01003095    OXU19992.1    ABLF02065839    NWSH01007753    PCG62823.1    NEVH01019963    PNF22185.1    GGMR01011511    MBY24130.1    GEZM01021881    JAV88842.1    GFTR01008246    JAW08180.1    ABLF02012739    ABLF02012741    NEVH01017470    PNF24199.1    GGMR01006408    MBY19027.1    GGMR01000676    MBY13295.1    KF280391    AIE77315.1    RSAL01000708    RVE41206.1    GGFL01005012    MBW69190.1    GFTR01008254    JAW08172.1    NEVH01016302    PNF25823.1    GECL01003538    JAP02586.1    AF237761    AAF81411.1    GGMR01012305    MBY24924.1    ABLF02013806    ABLF02016612   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
PF04937   DUF659
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
778
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
9.24702999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00021
outside
1  -  778
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
1.093618
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号