SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03886
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.425 Nuclear   Reliability : 1.249
 

Sequence

CDS
ATGTATTGTTCTCCTAACCCAAAAAAAACTGATGAAAGTGTGGGCGGCAACACGGGCCGCGAAATATCTACGGCACCGTTTAAGGTGCCAACCGTGGCAGCAAAAGCTGTAAGATGCGAGAGCGCACTCTCGATGCGGTCGGGAAGTGCTGCTTCCGTGAGGAGTAGCGCCTCGAGTGACCGAGGGTCGCTCTCGGTAGATGAAATGAATAGTACGATTGTAGGAGGAAGAGCACTCCGCAAACGTAAAACGGCTCCGCGAGCGGCGGCTTCCCGCCCTTCTGACTCCTCGGAGGGGGAACCCGCACCGCCCGCGAAATTCCTCGCCTTAGAGGAAACCACGGCACCAGTCGGTGGTCGCCAGGTGGCAACGGACTCTGCCAGTGCAGAGGTCGAGCGACTCGTCCGCTCCCTCACCGAGGTGGGGTTCGAAGACTCCACAAAACTATTTAGGGTCGCCTCGGATATTGTATCCAGTGTGGCAGCCAAATCGGGCAGGGGTTTTAAGGGCATATACCTGCATGCTCTTAAGTGCTTGGGTGCCACAATTGAAGACTACCTTAACATAGTTACTCACAAGACGAGCGGCGAGAACGAGGAATGCGTGCGACTGCAGAGAGACCAGCTCAAGGCACAAAACGCCGAGCTGCAAAATAATAATCTTGAGCTACGGGCGGAGATCGCGACCCTACACATGCGGGTGGACGAACTCATGGCGGAGATACGTAGCCCGGCTCCACCCGATGTCGAGGAGGTAGCTGAGCTAAAGCGGCGGATCGCCATTTTAGAGGCGCGCAGTTCGCCAGTGGAGCGTGCAAGACCACTGCTCGCACACGAGCGGAGAGCTGGCACCCAGGTCAAGCCCCAGTCTGCCAAACAGAATAAGCAGCCTGCCAAGCACGATCAAACCCAGCCGATCACCCTGGCCAAGCTTCATGTAGCTAAGCAAGCCAAGGCCCAGCAGCCGGTCCCTACCAAGCCACAGCCTGCCGTAGCGCGTACTGGAAGGGACCGAACGAAGAAGAAAGGCGTGAATGCTGCCAAAGTGATGCAGTACCCTCAGCCCTGCCCGCTGCCTCCGGTCCCATCCAGCATGGACGTAGCGTGGACGACAGTGGTAAAGCGGGGACAAAGAAAGACGAAGGAAGGACAAAGAAGCCCTCGGTCTGTCCAGGCAGTTGGCGCTCCCCGCGTAGAGGGTCCAGCGGTGAAGATACGGAAGAACCGTCGAGGAGGAAGATCCGGCAAGACACGCGCTCCGCGGTCGGCTGCAGTTGTTTTAGAATTGCTGCCGGCCGCTAAAGACAAGGGTATCACTTACGAAGAAGTGATGGCCCGGGCGCGTGGTGGCGTGGATATTGACGCCATCGGAGTGGAAGGCGGACTGAAGGTTCGACACACGGCTAACGGCGCTCGTTTGCTCGAATGTCCCGGTGCTGACTCAGGAGCGGTTGCGGACCGACTTATGGCCCGGCTCCGCGAGATCTTGCCTGATCCGGAGGTGGTGAGGATCGACAGGCCTGTCAGAATGGCGGAGATCAAGGTGACGGGCCTGGACGAGTGCGCCACGAAAGAGGAGGTGGCTGCCGCTATCGCATTGCAGGGGAACTGTGCTCTTGCAAACGTCAAGGTGGGGGAGCTTCGGAGTACATATTCCGGAACTCGCTCTGTATGGGCGCGGTGCCCCGTACAGACAGCCACCCTACTGGCTACGCCTGCACAGGGAAAGCCCGCTGACACGCCCGGTAGGCTACGCGTGGGGTGGGTTATTGCCCACGTGCAGTTGCAGGAAGCTCGACCATGGCGATGCCTTCGATGTTTCGGCACCGGGCACGGCCTCGCCAAGTGCTCGTCAGCTGTTGACCGCAGCGGACTATGTTTCCGGTGCGGCCAATCTGGGCACAAGGCCGCTTCCTGCACTGCCGCCATGCCACACTGTGTATTGTGCGACGCGGAGAAGCGGCGGGCCAACCACCGGGTTGGTGGCCCAGCATGTCATTTTACATCTTTCTCATCCAAGAGGAGGAAGGGTAAAATAAATAAAAAGAAACCGGTTGCAAATAAAGCAGCTGGCGAGTCAGTTCCCGCCGCGGTCCTAGAGCCGGAGGGCGGGACGGACGAAGGAGCAATGGACGCGAATTTGAACCACTCCGCCAGGGCGCAGGATCTCCTCGTCCACACCATGGTGGAGTGGTCAATCGATGTTGCCATAGCCGCGGAGCCGTACTTCGTCCCTGCGGACCAGGATGCCTGGATCGGGGACGTCGACGGCTCCGTGGCTATTACTATCAGGCAGGCCGCGGCGTTACCCCCCCTGGTGATGGTGGCCAGGGGATCCGGTTATGTCGCGGCCAGGGTCGACGAAACCGTCGTGATCGGGGTATACTTCTCTCCGAATAGACATCTCGCCGAGTTCGAGCAGTTCCTGGGCGGGCTTGAGGTGTTGGTTCACCGCCTCGGGTCCCGCCCGGTTATCTTAGCGGGAGACCTCAACGCAAAATGGGTGACTTGGGGTTCCCCCCGCTCGGACTCACGCGGCAGGATGCTCTCGGAGTGGGCGATCGCGGCTGGTCTCTGTCTTTTGAACAGAGGTTCGGTCGCGACTTGCGTGCGATGGAACGGCGAATCTCACGTGGACGTGACATTCGCATCTCCGTCCATCGCACGCCGCACACGTGGCTGGCGCGTTCTTGAGGGGGCGGAGACGCTCTCGGACCATCGATACGTCCGATTTGAGCTCTCAGCCTCCTCTCGATCCGCGTCGGCTATGAACGCCCGCGGTGAGGAGGAGCTCCCGCGAAGTGCTCCTCGGTCATTCCCCAGGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGGTGGAGGCAGCCACGGTGGCTGCGTGGGCACCCGTGCCTACTAGCCCCGTGGACGTGGAGTCAGAGGCTGACTGGTTCCGGGGAACGATGGGTCGTATTTGTGACTCAGCGATGCCCCGGGTAGGCAGCAGTGCTCCGCGTGGCGGTGCGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGAGGAGTGCGTGCGGGCGCGCCGCCGGAGCGCTCGCCATCGCCGCCGCCGCCTTCGCGATGAGGACTTCGCGGAGGTAGCGGACCGGTTGCGCGCCGACTGCCGCCAAAAGCAGGAAGCGTTGCGACTGGCCATCGGTGAGGCCAAATCTCAGGGCATGCAGACTCTCTTGGAGATGCTCGATCAGGATCCCTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCAGTGACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCAGATGGAGAGGGACTTTGAGCCTCCCTCCATGGGCGCGCCGCCTCGCAGTGACGTGAGCGGTGTTGCTGAGGTGGTCCCTCCGAGCATTTTGGAGGAAGAGATTCATGCGGCCGTGTTGAGGATGCGGAGAAAAGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGGCTCGTGCGGCTCTTTGAAGCCTGCTTCGAGTCGGGACGGTTTCCTAAGCAGTGGAAGACGGGCAGACTCGTCCTTCTGAGGAAGGAGGGGCGCCCCGCAGACTCACCTGCGGGGTACCGCCCCATCGTGTTGCTGGACGAGGCGGGAAAATTGTTGGAGCGAGTTATCGCCGCCCGCATCGTCCGGCACCTGACCGGGACGGGTCCCGATCTGTCGGAGGAACAGTATGGCTTCAGAGAGGGCCGCTCTACTATCGACGCGATTATGCGCGTGCGTGCCCTCTCTGACGAAGCTGTCGCCTGCGGTGGGGTGGCCTTGGCGGTGTCCCTGGATATCGCCAACGCTTTTAACACCTTGCCCTGGTCAGTGATCGCGGGGGCGCTCGAATATCATGGCGTCCCCGCGTACCTCCGCCGACTGATCGGGTCCTATCTCGAGGACAGATCGGTCGTGTGCACCGGACACGGTGGTGCGGTGCTCCGCTTTCCGGTCGAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCCTGTGGAATATCGGTTACGACTGGGCTCTGAGGAGCGCCCTGCACGGCCCTCTCCCGGGCCTAAGCGTTGTGTGTTACGCGGATGACACGTTGGTCGTGGCCCGGGGGAGGAACTACCAAGAGTCTGCTCGTCTTGCCTGCGCAGGGGTGGCATTCGTCGTCGGTAAGATCCGAAGGCTGGGCCTCGACGTGGCCCTCGAGAAATCCCAGGCCCTGCTGTTTCACAGGGCTGGGAGAGAGCCGCCACCCGGGGCCCACCTGGTGATTGGAGGCGTCCGCGTCGAGGTCGGGGTGACTGGGTTACGGTACCTCGGTCTCGAATTGGACGGTCGTTGGAACTTCCGCGCTCATTTCGAGAAGTTGGCCCCCCGACTGATGGCGACGGCTGGATCGCTGAGTCGGCTCTTGCCAAACGTCGGAGGGCCTGACACGGTGGTGCGCCGCCTCTACGTGGGGGTGGTGCGGTCTATTGCATTATACGGAGCCCCCGTGTGGTGCCGCGCCTTGACTCGCAGAAACGTCGTGGCGCTGCGACGCCCGCAGCGTGCAATCGCAGTCAGGGCGATTCGTGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCGTTCTCGCCGGGACGCCTCCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTATGCGTGGCGTTGTGACCTTCGCGACAGGGGGGAACCACGTCCCGGAGAAGGAGCAATTAGAGCGCGGAGGCTCCAATCTCGGCGGTCTGTGTTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGTCTCCGGACCGTCGAGGCGGTGCGCCCGGTCCTCGCGAAATGGGCGAACCGTGACCAAGGGCGTCTCACCTTCCGGTTGACGCAAATGCTTACCGGCCATGGGTGTTTTGGCCGGTACCTGCATCGCGTTGCCCGGAGGGAACCGACGATGGAGTGTCACCACTGTGACTGCGACGAGGACACGGTCGAGCATACGCTCGCATATTGCCCCGCATGGGTGGAGCAACGCCGTGTCCTTGTCTCGCAAATAGGACCGGACTTGTCGCTGCCGACTGTCGTGGCTACGATGCTCGGCAGCGATGAGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGAACGAGAGAGGGAGAGCTCATCCCTCTCCGCACCTATCCGTCGCCGCCGAGCCGGGGGCCGCAGAAGGGCTTTTGTCCGACTTCGGCCCCTGTAA
Protein
MYCSPNPKKTDESVGGNTGREISTAPFKVPTVAAKAVRCESALSMRSGSAASVRSSASSDRGSLSVDEMNSTIVGGRALRKRKTAPRAAASRPSDSSEGEPAPPAKFLALEETTAPVGGRQVATDSASAEVERLVRSLTEVGFEDSTKLFRVASDIVSSVAAKSGRGFKGIYLHALKCLGATIEDYLNIVTHKTSGENEECVRLQRDQLKAQNAELQNNNLELRAEIATLHMRVDELMAEIRSPAPPDVEEVAELKRRIAILEARSSPVERARPLLAHERRAGTQVKPQSAKQNKQPAKHDQTQPITLAKLHVAKQAKAQQPVPTKPQPAVARTGRDRTKKKGVNAAKVMQYPQPCPLPPVPSSMDVAWTTVVKRGQRKTKEGQRSPRSVQAVGAPRVEGPAVKIRKNRRGGRSGKTRAPRSAAVVLELLPAAKDKGITYEEVMARARGGVDIDAIGVEGGLKVRHTANGARLLECPGADSGAVADRLMARLREILPDPEVVRIDRPVRMAEIKVTGLDECATKEEVAAAIALQGNCALANVKVGELRSTYSGTRSVWARCPVQTATLLATPAQGKPADTPGRLRVGWVIAHVQLQEARPWRCLRCFGTGHGLAKCSSAVDRSGLCFRCGQSGHKAASCTAAMPHCVLCDAEKRRANHRVGGPACHFTSFSSKRRKGKINKKKPVANKAAGESVPAAVLEPEGGTDEGAMDANLNHSARAQDLLVHTMVEWSIDVAIAAEPYFVPADQDAWIGDVDGSVAITIRQAAALPPLVMVARGSGYVAARVDETVVIGVYFSPNRHLAEFEQFLGGLEVLVHRLGSRPVILAGDLNAKWVTWGSPRSDSRGRMLSEWAIAAGLCLLNRGSVATCVRWNGESHVDVTFASPSIARRTRGWRVLEGAETLSDHRYVRFELSASSRSASAMNARGEEELPRSAPRSFPRWALKRLNKELLVEAATVAAWAPVPTSPVDVESEADWFRGTMGRICDSAMPRVGSSAPRGGAYWWSPEIAQLREECVRARRRSARHRRRRLRDEDFAEVADRLRADCRQKQEALRLAIGEAKSQGMQTLLEMLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPQMERDFEPPSMGAPPRSDVSGVAEVVPPSILEEEIHAAVLRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLFEACFESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVIAARIVRHLTGTGPDLSEEQYGFREGRSTIDAIMRVRALSDEAVACGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVERGVPQGSVLGPLLWNIGYDWALRSALHGPLPGLSVVCYADDTLVVARGRNYQESARLACAGVAFVVGKIRRLGLDVALEKSQALLFHRAGREPPPGAHLVIGGVRVEVGVTGLRYLGLELDGRWNFRAHFEKLAPRLMATAGSLSRLLPNVGGPDTVVRRLYVGVVRSIALYGAPVWCRALTRRNVVALRRPQRAIAVRAIRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRDRGEPRPGEGAIRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLAKWANRDQGRLTFRLTQMLTGHGCFGRYLHRVARREPTMECHHCDCDEDTVEHTLAYCPAWVEQRRVLVSQIGPDLSLPTVVATMLGSDESWKAMLDFCECTISQKEAAERERESSSLSAPIRRRRAGGRRRAFVRLRPL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01421   Reprolysin
PF00098   zf-CCHC
PF00075   RNase_H
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR000663   Natr_peptide       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=2.98172e-09,     Score=154

Ontologies

Topology

Length:
1775
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04633
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1775
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
277.817233
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号