SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03862
Pre Gene Modal
BGIBMGA010176
Annotation
PREDICTED:_uncharacterized_protein_LOC101740250_isoform_X2_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.278
 

Sequence

CDS
ATGTGCGAGCCTTTAGATATGGATTTAGCTATGGAGGACTTCGAATTTACGCAGGATGAATGGAAGCAAATCAACGCGTTAGAAATTTCTTTTTCGATCGCTTCTATAAACAATGACGCTCTCGTAGAATCGGATAGTGAACCCATGCAATTACCGAAAAAGAAAAGACGTTTGGTTATCGCAAGTGATAGTGATAGTGACAGTGAGTCGGCTGAAAATTTTGTTGCCGCCAATATATCGCAAAATGACCGTATTTCCTCAAAATGGTCGAGGCCAAAAAGACGACAGCCATCAGTGATTCCTTTCACCGAGTTCGAGGGTATGAAACCTCCATATTCTAATTTGCTGAAAGAAGCTGGCCCTGACCAGTATTATGATCTATTGGTGCCTGAAGAAATTCTTGAAATGATTGCTGAGCAGACAAATTTGTTCGCAAGTCAAAACATCACAGCCAGGCAAACAAAGCCTGGATCAAGGTCTCATTCATGGAAGCCAACAAACAAGACAGAAATAAAACAGTTTCTTGGGCTGGTCTTGTTTATGGGCGTAGTAAAGCTGCCGAAATTAGCTTATTATTGGAGCAAAGACAAGATACTTGGACAAACTTTTCCAGCCACCGTTATGAGTAGGAACCGCTTCGAGTTACTACTGCAATACCTACACTTTAGCGACAATTTATCTGTCGACAGAAACGATCGTATTGCCAAAATAAGACCTTTAATCGATGCTCTCAATGCTACTTTCCAGAAATATTATTCACCTAAAGAAGATGTTTGTGTGGATGAAAGCCAAGTACCTTTCAGAGGTCGAATAATATTCAGGCAATACAATAAAAGTAAGCGACACAAGTATGGCATGAAGCTATTTAAGTTATGTACTGTTCCCGGATATACTTGCAAACTTAATTTGTATAGTGGGAAAAACATTGACGCAATAAATACTACGCCAACAAATCTGGTGATGGCACTATGTGAAAATATATTTGACAAAGGACACACGCTAGCAACTGATAATTGGTACACTAGCTTGCAACTGGCTTATCGGTTATTGGAGAAGCAAACCCATTTAATTGGCACATTGCGAAAAAACAGAAGAGGATTGCCTAAGGCTGTTGTTGATTCGAAACTGCAAAAAGGTGAAACAATGGCTATGGAGAATGAAGATGGAGTAACAGTGCTTAAATGGAAAGATAAGAGGGACGTGCTTATGCTGTCGACAAAGCATTCCGACAAAATTGCTGTGGTGGTGAAAAAAGGCAAACAGATTCGTAAACCAAAAGTTATTTTGGATTATAATAAATCGAAAGGGTCTGTAGACATGAGTGACCAGATGGGTGCCTATTCTTCGCCATTGCGGAAAACCGTAAAATGGTATAGAAAATTGGCAATAGAACTACTTCTAAATACGGCAGTTGTAAATGCTTGGGTCATGTACAATGAAAATAAGCAGAGCAAATCTTCAATTGTCGACTTTAGGAGGGCTCTCATAAATTATTTGACTCGGCCAGCAGATTCCCAAGAAATAATTATCAATGAAAGACCTAAAAGACTCAAGCATGTTCTAAAATTAAAGGAAGGAAAAGTAAGAGACACGCGTCGTTTTTGCGTGAAATGTTATAAAGATTCAGTACAGGCATTTGGTCGTAAAGTAGCTAAGAATAAAGCTAAGAAAATGAGCCTCCGAATAGCAAGATGCTTCTCGTACTGTAACACTGAGGGGGAGCTGCACACGTTCACCGACGCCAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAGGACAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAAGCTGGAGCTGCAAGCTGCACTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCGGTCGGTGGAAGGACGTACTGGACTGACTCCAGCACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAGCCTTTCGTCGCGCACCGACTTGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCATAGGCATCGGTGGTTTAACGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTTCCTGGTGGCCACGGCGAGGACCGCTGACGCTCGACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATTGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGCAGTTAAGGACCCCGGAAGCACCTAAAGAAGCAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACTACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTATTACAACGCGACGTGGAATGTCATGGACGTATAGTCAGCTCAGTGGTGCGGTTGTGCCGCGGCGGTGACGCAGCCCGCGCCCTAGAACGACGCTGGCATCTCCTGTACCTCCGAGCCATCGAGTGGCAGTGTCACCTAGAGGCCTGTTTGACCAAGATTAACACTCAGGGTGGAACATCAATTGAAGCTGTAAGTGACAGTGATGACGAACCGGCTCTAAAACAACCGAGACTCAGCAGAAAAGGCTCTCCGCGGAGTCCAAGAATACCGAGAAGTCCACGTAGACAACGCACTCCGGTTAATGCTCGCTGCAGAGAAAACTCTACTGACAGTCGACAGTCAGCATCAGAGGAGGAACAAGAATATGTACTGACGTATACGTGGAGGGGATTCGGATCTGACTGCGAATCGGAACTGATGAGGGAACAAAGCAACATGGCAGACGAGAGGAGAGTACCCGGCTCGTTTGAGGACATGGACGTAAGAACCACTGACCAGACTGTACCTGTCACTGTTGACCAACTTGACGGCCTCGATATAAACAGCTCAGTTATTATAGAGGAGAAACTCAAAACGCCACCGACAGTGATTAAACGTAAGAAACCAATAGACACGTCGAAATTCAATCAGACCGATCGAAAATCCAAACATCTAGCAATCTTCTACTTCAAACACCACGATACGGATTCAGACAGACAAGTTATTGAAACGGACGAAAAAAGCCAAGAGGAATCTTCCGAAGAAGAGTGGACGTACGTTGGCGGTGCTAAAATAGCCAACGAAGACTCAACTGATCTGATGACGTCATCTGTGGAAATACAATGTGAGCTACCAGTTGACAATCAGAAAGACACACCGGCATCCCCGAAACTGAAACTAGAATCATCGACGCCTGATTTACTGCGAGTCGAAAATACTAGATGTAAAGACATAGAGAGATTAGTGAACCAGGCTGAAGAAATGGTGCATAAAAAGGCTATGGCAAAGAAGAAGGGAATTAGGAACTTCAAGCCATTGAGCTTGGAAACTGACGGAAAAAATGTTAGCAGGAACAAAATGTCCAGGATCAAGGAATGGCTGAATCAAAGTCCGGATGGAAAGAACGAAAACAATCAGAACACGGAAAGCTATGATGCGTCTGGCGAATACACGACGGAAAGCGAAGTGGACACATCACTTACATCTGAAGAACGGAACCTACACTCCTCCATGGATATGAGCACCTCCACTTGTACAGTAACGCCGACACATCATGCCAAGGTTACATTAAGAAAGAAACGCGCCGGTAACAGCACTAGGCCTTGGTCCGTATCGTGTTTGTCTCAACTGAGCGGTGCGGGCGCATCCCTAGCCGCCACGCCGACAGCGGCGGACGCGCCGAACATGACACACAACATGTCCATATCGGAATCTGCGCTAAACACGCTAGCCTCCCCGCATACAGTCACGCCTTCGAACTCTAACTCGAAATTAAGGGGCAGCTCTACAACTGTACAGGGTCACGTATCAAGCACGAACACAATGACGGAAGCCTGCACGTCGTGCGTCGAAGCCAACGACAAACAGTGCTGGTTACGGCGCAAGCGTTTCAAGCTCCGCCGCCACAACGCACCGCAAAATTCCAGGAGGGAGAGGCTGGTCAAGTCTCTGTCGTTCTGCGGAAGGCTCAGCCCTGAAATAGAAGATAAAAATGAGAGGAGCGCCGCGAGTGACCCGGCTACAAGAAAGAGCAGGTTCGACACGACCTCAACCTCGGGCAACGACAGCGACGAGGAACTGATAAAGCAACAGTTGGCAGCGATGGCGAACCTACGCAAGAGCATCGAGAAGACCCACATATCGACACGCGAAGACGGTGCCATCCCGGAGCAGAACGAACAAAACGATCCAGAAAACACGTCCAAACCCGAATTCAAACTCGGGCCGGCCGGCGGAACGGTTCGACCGAGGTTAGCGAGGAGCTTGGAAAGGGAACGGAACTTCTTGGCGCTAAGCCTCGGCGATCCGAACCAGCTCTGGGATCTGAGTTTGGACAAAGATTCGGACGTGGACAAAAGCGTGACGGCTGGCACAGAAGAGCACAGCTCGTTCTCGGAACAAGCCTGGGACTTTTATCAAGTGAGTCTAGGCTCTTAA
Protein
MCEPLDMDLAMEDFEFTQDEWKQINALEISFSIASINNDALVESDSEPMQLPKKKRRLVIASDSDSDSESAENFVAANISQNDRISSKWSRPKRRQPSVIPFTEFEGMKPPYSNLLKEAGPDQYYDLLVPEEILEMIAEQTNLFASQNITARQTKPGSRSHSWKPTNKTEIKQFLGLVLFMGVVKLPKLAYYWSKDKILGQTFPATVMSRNRFELLLQYLHFSDNLSVDRNDRIAKIRPLIDALNATFQKYYSPKEDVCVDESQVPFRGRIIFRQYNKSKRHKYGMKLFKLCTVPGYTCKLNLYSGKNIDAINTTPTNLVMALCENIFDKGHTLATDNWYTSLQLAYRLLEKQTHLIGTLRKNRRGLPKAVVDSKLQKGETMAMENEDGVTVLKWKDKRDVLMLSTKHSDKIAVVVKKGKQIRKPKVILDYNKSKGSVDMSDQMGAYSSPLRKTVKWYRKLAIELLLNTAVVNAWVMYNENKQSKSSIVDFRRALINYLTRPADSQEIIINERPKRLKHVLKLKEGKVRDTRRFCVKCYKDSVQAFGRKVAKNKAKKMSLRIARCFSYCNTEGELHTFTDASEKAYACAVYWRQRTDESTYRVTLLAGKARVTPLRPVSIPKLELQAALLGTRMAQAIADELDIAVGGRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHRHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLKQQDPTWRTTRTKQPRSTWQLRTPEAPKEATSGGLLKRPASKMILLVPATSDEPTPIESPLQGVGATHEGEDVLQRDVECHGRIVSSVVRLCRGGDAARALERRWHLLYLRAIEWQCHLEACLTKINTQGGTSIEAVSDSDDEPALKQPRLSRKGSPRSPRIPRSPRRQRTPVNARCRENSTDSRQSASEEEQEYVLTYTWRGFGSDCESELMREQSNMADERRVPGSFEDMDVRTTDQTVPVTVDQLDGLDINSSVIIEEKLKTPPTVIKRKKPIDTSKFNQTDRKSKHLAIFYFKHHDTDSDRQVIETDEKSQEESSEEEWTYVGGAKIANEDSTDLMTSSVEIQCELPVDNQKDTPASPKLKLESSTPDLLRVENTRCKDIERLVNQAEEMVHKKAMAKKKGIRNFKPLSLETDGKNVSRNKMSRIKEWLNQSPDGKNENNQNTESYDASGEYTTESEVDTSLTSEERNLHSSMDMSTSTCTVTPTHHAKVTLRKKRAGNSTRPWSVSCLSQLSGAGASLAATPTAADAPNMTHNMSISESALNTLASPHTVTPSNSNSKLRGSSTTVQGHVSSTNTMTEACTSCVEANDKQCWLRRKRFKLRRHNAPQNSRRERLVKSLSFCGRLSPEIEDKNERSAASDPATRKSRFDTTSTSGNDSDEELIKQQLAAMANLRKSIEKTHISTREDGAIPEQNEQNDPENTSKPEFKLGPAGGTVRPRLARSLERERNFLALSLGDPNQLWDLSLDKDSDVDKSVTAGTEEHSSFSEQAWDFYQVSLGS

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1584
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.539169999999999
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.02624
outside
1  -  1584
 
 

Population Genetic Test Statistics

Pi
318.606298
Theta
194.284796
Tajima's D
2.684148
CLR
0.532092
CSRT
0.95895205239738
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号