SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03844
Annotation
PREDICTED:_uncharacterized_protein_LOC106710892_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.02
 

Sequence

CDS
ATGCTAGCCCTAAGCCCACTACCGTCACATTTGATAGAAAACAGTCAGAAGTACGAAATTAACAAAATTGAGACGGAAACTGACATAGATAAAGAACTTTGTGAAAATTTAAAGAAAATTCGTACCAGCCACATGAACGAGGAAGAAAAACGGGAAATTACTAAAATCTGCTATCAGTACCGTGACATATTCTACTCGGAAAACATTCCTTTATCGTTTACCCATACAGTAAAACACGAATTAAGACTAACCGACGACACCCCCATCTTTGTACGAAGTTATAGACAGGCTCCCCAACAACGAACAGAGATACAGAAACAGGTAGATAGTCTGTTAAAACAAGGAATCATTAGGGAAAGTATCTCCCCTTGGTCGTGCCCGGTACACATTGTTCCGAAAAAACCGGATGCATCAGGAAAAGTTAAATGGAGACTTGTTATTGACTATAGAAGACTTAATGACAGAATTATAGAAGACAAGTACCCCTTACCAAACATTAACGACATCCTTGACAGATTAGGGCGCGCACAATATTTCACGACCATAGATTTAGCAAGCGGCTACCATCAATTAGAAATGCACCCTAAAGACGTAGAGAAAACAGCGTTTACTACTGAAAGAGGCCACTATGAGTTCCTAAGAATGCCTTTCGGACTAAAAAATGCCCCGAGCACTTTCCAGCGTCTTATGGACCATATACTCCGAGGTATAGACAACGTATTTATGTACTTAGATTACGTCATAATAGCCGCGACGTCCCTACAAAACCACAATGAAAAACTGAAATTAGTATTTCAGCGATTCAAAATGCATAATCTGAAAGTTCAGTTAGACAAATCAGAATTTCTACAGAAGCACGTTAACTTTCTAGGACATGAATTGACTGACCAAGGACTAAATCCTAACAAGGACAAAATTAAAGCAGTATTAAATTTCCCTATACCACAAACGCAAAAAGACATAAAAGCTTTCTTAGGCCTAGTCGGGTACTATAGGAAGTTTATTAAGGACTTCGCGAAGTTGACGAAACCTTTAACAGCATGTCTAAAAAAGAACGCAAAGGTTGAACATACAAACGAATTTTTAGACGCAGTTGATAAATGCAAACAAATTCTAACAAACGCCCCAATCCTGCAATACCCTGACTTCGACAAACCGTTTATTTTAACGACAGACGCATCTGACTTTGCTTTAGGAGCAGTACTTTCCCAAGGCAATGTGGGCTCAGATAAACCAGTAGCCTATGCCTCAAGGACATTATCAGATACTGAGATCCGTTACTCTACCATAGAGAAAGAACTGTTAGGGATAGTATGGGCAATTAAGTATTTTAGACCTTACTTATATGGCCGTAAATTTACAATTTATACGGACCATAGACCCCTTACATGGTTAATGAGTCTAAAGGACCCTAACTCTAAATTAACACGATGGAAACTAAAGTTAGCAGAGTATGATTACAAAGTTGTTTATAAAAAGGGCAAACAAAACACTAACGCAGATGCACTATCTCGAGCAAAAATTTTTCATAATAGTATAGATTCTCTAGCTGTTAATGTTGATGACAATAGTGACGACAACATAATAAATAGAATATTCGAAAACGCCCGTAGACAGGCAGAGGTAGAAACTGATGACCCGAATAACCAAGACAATGAACGTAACAATACTGACAATGACGACCAACCTTATAACAACAATGACGTAGAAATGACCAGTATCTATCCCTCTCAAATTGACGAAGAGACAGACACAAGGAGTGCAACAACAGTCGACCCCGATCAATTAGTTTCTACAAATCATACCCAACCTGATAATGAAAATAACGGTATCCCTATAATATCCGACGCTATTGATAGACAGTTGAAACAATTTTACGTTAGGTCCACACCAGGTTCTACATACAGAGTAGAGGACAGATCAACAAACTCTAGGACAGTTATTAAGGATGTTTTCATCCCAGTAAATAACACTGAATCAGAAATTATCAAATTTTTAAAGGAACACACAATAGCTGACCGTGTTTTTCATTGCTATTTTTACGACGAAAATCTATACTTAGCCTTTTCAAGAGTGTATACTACGATATTTAATGACAGAGGACCTAAATTAATAAGATGTACTTCGCGGGTCACACTTGTTGAAAATAAAACTGAACAACAAGAACTCATTAAGCGATATCACGAAGGTAAATCATCGCATCGCGGTATCCAAGAGACCTTTAAGCATCTGCATAGGAATTATCACTGGCCTAATATGTTATTGACAGTTCAAAGGTTCATTAATCAATGCGACCTTTGCCTAAAGGCCAAATATGAAAGAAATCCTTTAAAACCTCCATTGATTATAACAGAGACACCTACGAAGCCATTTCAACACTTGTTCATGGATCTCTATAGTACTGGAGGTGCAACATTTTTAACAATTATCGACAATTTCTCTAAATTTGCCCAGGCGGTGCCTCTGAATGCTTCTAGTAGTGTTCACATCGCAGAAGCTCTATTACAAGTATTTTCTGTACTAGGACTACCTCTTAAAATCACCACAGACTCAGATACAAAGTTCGATAATGACGTCATAAAAGAGATATGTGCTTCGCATGATATCCACATTCACTTCACGACGCCTTACAACCCAAACTCTAACTCACCCATTGAACGATTTCATTCAACCATCGCAGAAATAATAAGAATTCAAAGAATGACAAATAAAGACGACCCCATACAATTGATCATGAAATACGCTATAATCGCCTATAACAACGCTATTCATTCTACTACAGGCTATACACCACGTGAGCTTTTATTCGGTCATACGGCATCCCGAAATCCATTAGAGCTATATTATCCTAAAGAATTTTATCAAGATTATGTCCTCAATCACCGCAAGAATGCAGAAGCAGTACAGGAATGTATAGCAGCCCACGTGTCTAAGAACAAAGAGCAGGTAATAGAAAAGAGAAACCAGGCAGCGCAAACAATCACGTTTAAGGTAGGTGAAACCGTTTACAAACAGGTCGCCAAAACCACCAGGAGCGACAAGACAAAACCAGTATTTAAAGATAAACAAAACCTCACCATTATTCCTAAATCCAAATACCTAGCACTGGGAACCAACGAGTACTCATACCTGGAGGAAGATTGCAAAAAGATCACACAAGACGTCCAACTCTGCACATCGCTGAACACCCAACCTGTGGAGAACTCTGAAGACTGCATAGTAACTCTTATAAAACACGAGAGCACAAACTGCACCCGTGCCAGGATGAACCTGAAACAAGGCAAGATCCAGAGACTAGAAGACAACAAATGGCTTATCATCTTGAAAGACGAACAAATCCTGAAATCTCGCTGCGGAAGGAAATCTGACTATAAAAAGATGTCAGGAATATACATCGCCAGCATTACAAGCGATTGTCAAGTGGAAATATTCAACCGAACACTGAAGACAAACACGGACACTATTACAGCTGATGAAATCGTACCCATTCCCAGCGAAACCACTATTCTAGAAGGGAATATTCGCTATAACCTACAACTGAAAGATATATCTCTGGATAGCATCCACGAACTGATGGACCGGGTTGAAAACATTCAACAACCTGTCATCGACTGGCAGACTATGATGACTACCCCAAGTTGGTCAACACTGGGACTCTACCTCATTCTGATAGCAATAATCATCTGGAAGCTGTGGCAGTGGAGACAGCGACGACTACAATCAAAGAACGAGAGCCCCGAGAACACTAGCATCGAGGACGCTGCTGGAAGCTGCGGGACGCGCTTCTATCTTAAGGAGGGAGGAGTTAGGCAATCGCCCGATGCCCGTATTTGCTGA
Protein
MLALSPLPSHLIENSQKYEINKIETETDIDKELCENLKKIRTSHMNEEEKREITKICYQYRDIFYSENIPLSFTHTVKHELRLTDDTPIFVRSYRQAPQQRTEIQKQVDSLLKQGIIRESISPWSCPVHIVPKKPDASGKVKWRLVIDYRRLNDRIIEDKYPLPNINDILDRLGRAQYFTTIDLASGYHQLEMHPKDVEKTAFTTERGHYEFLRMPFGLKNAPSTFQRLMDHILRGIDNVFMYLDYVIIAATSLQNHNEKLKLVFQRFKMHNLKVQLDKSEFLQKHVNFLGHELTDQGLNPNKDKIKAVLNFPIPQTQKDIKAFLGLVGYYRKFIKDFAKLTKPLTACLKKNAKVEHTNEFLDAVDKCKQILTNAPILQYPDFDKPFILTTDASDFALGAVLSQGNVGSDKPVAYASRTLSDTEIRYSTIEKELLGIVWAIKYFRPYLYGRKFTIYTDHRPLTWLMSLKDPNSKLTRWKLKLAEYDYKVVYKKGKQNTNADALSRAKIFHNSIDSLAVNVDDNSDDNIINRIFENARRQAEVETDDPNNQDNERNNTDNDDQPYNNNDVEMTSIYPSQIDEETDTRSATTVDPDQLVSTNHTQPDNENNGIPIISDAIDRQLKQFYVRSTPGSTYRVEDRSTNSRTVIKDVFIPVNNTESEIIKFLKEHTIADRVFHCYFYDENLYLAFSRVYTTIFNDRGPKLIRCTSRVTLVENKTEQQELIKRYHEGKSSHRGIQETFKHLHRNYHWPNMLLTVQRFINQCDLCLKAKYERNPLKPPLIITETPTKPFQHLFMDLYSTGGATFLTIIDNFSKFAQAVPLNASSSVHIAEALLQVFSVLGLPLKITTDSDTKFDNDVIKEICASHDIHIHFTTPYNPNSNSPIERFHSTIAEIIRIQRMTNKDDPIQLIMKYAIIAYNNAIHSTTGYTPRELLFGHTASRNPLELYYPKEFYQDYVLNHRKNAEAVQECIAAHVSKNKEQVIEKRNQAAQTITFKVGETVYKQVAKTTRSDKTKPVFKDKQNLTIIPKSKYLALGTNEYSYLEEDCKKITQDVQLCTSLNTQPVENSEDCIVTLIKHESTNCTRARMNLKQGKIQRLEDNKWLIILKDEQILKSRCGRKSDYKKMSGIYIASITSDCQVEIFNRTLKTNTDTITADEIVPIPSETTILEGNIRYNLQLKDISLDSIHELMDRVENIQQPVIDWQTMMTTPSWSTLGLYLILIAIIIWKLWQWRQRRLQSKNESPENTSIEDAAGSCGTRFYLKEGGVRQSPDARIC

Summary

Pfam
PF00078   RVT_1        + More
PF17917   RT_RNaseH
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF02902   Peptidase_C48
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF54001   SSF54001       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=4.59604e-76,     Score=729

Ontologies

Topology

Length:
1278
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.18375
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00012
outside
1  -  1209
TMhelix
1210  -  1232
inside
1233  -  1278
 
 

Population Genetic Test Statistics

Pi
37.866634
Theta
37.444689
Tajima's D
-0.55784
CLR
355.311613
CSRT
0.232188390580471
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号