SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03840
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.322 PlasmaMembrane   Reliability : 1.555
 

Sequence

CDS
ATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTTACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGAATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTGGCGGTTCGTTCTTTGCGGGAGCTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGGAGTATCAACAGGATCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGATGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTTCCTGATATTAACCACGTGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGCGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCTAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACAATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTACTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTGTATGCTTGGACAGACAGCCAGATAGTGTTGTGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGATCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACAATGAAGGCTTCTCAGTGGCCACCCTCTCGCATAGGAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCGAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGCCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCGCTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGTTTTCATTCAGAATTGAAGGCGCTAAGGACTGAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGCTGATTCGAGTGGGAGGTAGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCCAAGAAGAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGCTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGAGTGAAGAAGATGAGGCCATTTTCTGGAGTTGGTACGGACTTCGCTGGGCCCTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTCTTTGTCTGTCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGTTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGTTAACTACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCACGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTACCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCTCGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTEYQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHVSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTMKASQWPPSRIGVPPGLVAAPAQFEDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLPVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTERPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    + More
JAT32778.1    JAT39755.1    GEZM01085145    GEZM01085143    JAV60187.1    GEZM01054765    JAV73413.1    ABLF02005684    ABLF02039606    JXUM01030959    KQ560903    KXJ80414.1    LBMM01009888    KMQ87813.1    GGMR01014165    MBY26784.1    GALX01004947    JAB63519.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GDHC01021148    JAP97480.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GEZM01018702    JAV90048.1    LNIX01000007    OXA51795.1    LNIX01000036    OXA39969.1    LNIX01000016    OXA46198.1    ABLF02021785    GEBQ01018232    JAT21745.1    GGMS01009443    MBY78646.1    ABLF02054908    LBMM01009202    KMQ88311.1    GECZ01006169    JAS63600.1    LBMM01009964    KMQ87756.1    GDHC01006469    JAQ12160.1    LNIX01000069    OXA36894.1    GGMR01002024    MBY14643.1    LNIX01000002    OXA59522.1    OXA60848.1    GGMR01002187    MBY14806.1    ABLF02030854    ABLF02067347    GGMR01010723    MBY23342.1    ABLF02035110    GEZM01060254    JAV71154.1    ABLF02035780    GGMR01005823    MBY18442.1    ABLF02041614    ABLF02006304    ABLF02036268    LBMM01009645    KMQ87967.1    GGMR01013370    MBY25989.1    LBMM01009941    KMQ87772.1    LBMM01009688    KMQ87939.1    LBMM01012188    KMQ86362.1    LBMM01010405    KMQ87487.1    GBHO01044316    JAF99287.1    ABLF02008636    ABLF02065931    KK114194    KFM61875.1    ABLF02015138    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GEBQ01000825    JAT39152.1    ABLF02022040    ABLF02056888    GEBQ01015458    JAT24519.1    GGMR01016460    MBY29079.1    LBMM01009551    KMQ88039.1    GEZM01066272    JAV68024.1    GBHO01023090    JAG20514.1    LBMM01006490    KMQ90572.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMS01012379    MBY81582.1    GFTR01008866    JAW07560.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LBMM01009863    KMQ87831.1    GBRD01007977    JAG57844.1    GGMR01006575    MBY19194.1    GL769615    EFZ10365.1    LBMM01008464    KMQ88855.1    GDHC01014057    JAQ04572.1    LNIX01000005    OXA54454.1    ABLF02043036    GGMR01000737    MBY13356.1    GFTR01008874    JAW07552.1    GDHC01006567    JAQ12062.1    ABLF02028666    ABLF02066713    GGMR01014351    MBY26970.1    GBHO01007689    JAG35915.1    ABLF02025193    ABLF02036131    ABLF02041527    ABLF02064049    GBHO01045636    GBHO01045635    JAF97967.1    JAF97968.1    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    LBMM01010417    KMQ87475.1    GGMR01002421    MBY15040.1    GEZM01021505    JAV88969.1    GGMR01018294    MBY30913.1    ABLF02067195    GGMS01006636    MBY75839.1    GDHC01002235    JAQ16394.1    GGMR01018506    MBY31125.1    GEHC01000869    JAV46776.1    JXUM01113346    KQ565681    KXJ70776.1    GGMR01017890    MBY30509.1    ABLF02041650    ABLF02008594    ABLF02024568   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00078   RVT_1
PF09337   zf-H2C2
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR005312   DUF1759        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR015416   Znf_H2C2_histone_UAS-bd       
IPR000727   T_SNARE_dom       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D
PDB
5UOQ     E-value=0.0588198,     Score=89

Ontologies

Topology

Length:
1006
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00701
Exp number, first 60 AAs:
0.00043
Total prob of N-in:
0.00018
outside
1  -  1006
 
 

Population Genetic Test Statistics

Pi
155.603012
Theta
15.865939
Tajima's D
-0.808006
CLR
26.724462
CSRT
0.176841157942103
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号