SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03829  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010088
Annotation
PREDICTED:_AFG3-like_protein_2_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.349
 

Sequence

CDS
ATGTTCTCGCCTTCTAGCAGCAGCGGAGGTGGAAGTGGAGGCCGCGGCGGCTATGAAGGCCAAGATAAAGAGAAGTGGATGATGTTTGGAGCAATTGGTATTGTGACATTGCTTGCTTCAGTTGCGTATTTTGAATTAAGATACAGAGAGATAAGTTGGAGAGATTTTGTCAATTTGTATTTAAACAAAGGTGTGGTCGAGAAACTAGAAGTTATTAACAAAAAATGGGTCCGAGTAAAACTTCAAGGGAATGCATTAGAAGGAAAGGTTATTTGGTTTGCAATAGGTAGTGTCGATTCATTCGAACGTAATCTAGAAAATGCACAAATTGAAATGAGCATTGATCCTCCTAATTTTGTACCAGTTATTTACAAAACTGAAGTAGAGGCTGCCAGTCTGACGGGAATGCTTCCTACTCTACTAATAATTGGGTTTTTAATATACATGATGAGAAGATCTGCAGACATGATGGGACGCGGTGGCCGTCGTGGAGGAGGCTTGTTTGGAGGAGTGATGGAGTCAACAGCTAAATTAATAAATCCAACAGACATTGGAGTAAAATTCCAAGATGTTGCTGGTTGTGAAGAAGCAAAGATAGAAATTATGGAATTTGTCAACTTTCTTAAAAACCCTCAGCAATATATAGATTTGGGAGCTAAAATTCCCAAAGGTGCACTATTAACAGGTCCTCCCGGTACTGGTAAAACTTTACTCGCAAAAGCAACTGCAGGAGAAGCTAATGTACCATTTATCACTGTCTCTGGTTCAGAATTCTTAGAGATGTTTGTAGGTGTTGGTCCTTCCAGAGTAAGAGATATGTTTTCTATGGCACGTAAACATGCTCCATGCATACTGTTTATTGATGAAATTGATGCTGTAGGTAGAAAAAGAGGAGGTCGTAGTTTTGGTGGTCATTCAGAACAAGAAAACACTTTGAATCAACTGTTGGTTGAAATGGATGGATTTAATACAACTACAAATGTTGTGGTACTTGCAGCTACAAATCGAGTAGATATATTAGATAAGGCATTGTTGAGACCTGGTAGATTTGATAGACAGATATTTGTCCCAGCACCAGACATTAAGGGCAGGGCCTCAATTTTCAAGGTGCATTTGACTCCTCTCAAGACAACGCTGAATAAGGAAAATTTAGCAAGAAAAATGGCTGCATTGACTCCAGGTTTCACCGGCGCGGATATTGCTAACGTGTGCAACGAGGCGGCACTAATTGCCGCTCGCGAATTAGCCAACGATATTACAATGAAAAATTTCGAACAAGCCATCGAAAGAGTCGTCGCCGGTATGGAGAAAAAATCTAATGTTCTCCAACCAGACGAGAGGAAGATTGTAGCGTATCATGAGGCCGGCCATGCAGTTGCAGGTTGGTTCCTACAACATGCAGATCCCCTTTTAAAAGTGTCTATTATACCTAGAGGAAAAGGTCTTGGCTACGCGCAATATTTACCCAAAGAACAGTATTTATACAGCAAGGAACAACTATTTGATAGAATGTGCATGACACTAGGGGGTAGAGTAAGTGAAGAGATATTCTTCGGAAGAATAACCACAGGGGCTCAGGATGACTTAAAAAAGATAACACAAAGCGCTTATGCGCAGATTGTACACTATGGTATGAACGCTAAAGTCGGAAATGTGTCTTTCGAGATGCCACAGCCCGGTGAAATGGTGATTGACAAACCATACTCTGAAAAGACCGCAGAACTCATCGATTCAGAAGTCAGAGACCTGATTAACAATGCGCACAAACACACAACGGATTTATTAACAAAACACAAACCTAACATCGAAAAGGTTGCAGAGAGATTACTGAAACAGGAGATTTTGAGTCGCGATGATATGATTGAACTGTTAGGGCCTAGACCGTTCCCCGAGAAGAGTACTTATGAAGAGTTCGTTGAAGGCACAGGATCATTAGATGAAGACACGACGCTACCAGAAGGCCTCAAGGATTGGAATAAGGAGAAACAGCCCACAACACCACCGCCGGAAACCAGCCCATCAAGCCCCACAGCCAGTAAAAAATAA
Protein
MFSPSSSSGGGSGGRGGYEGQDKEKWMMFGAIGIVTLLASVAYFELRYREISWRDFVNLYLNKGVVEKLEVINKKWVRVKLQGNALEGKVIWFAIGSVDSFERNLENAQIEMSIDPPNFVPVIYKTEVEAASLTGMLPTLLIIGFLIYMMRRSADMMGRGGRRGGGLFGGVMESTAKLINPTDIGVKFQDVAGCEEAKIEIMEFVNFLKNPQQYIDLGAKIPKGALLTGPPGTGKTLLAKATAGEANVPFITVSGSEFLEMFVGVGPSRVRDMFSMARKHAPCILFIDEIDAVGRKRGGRSFGGHSEQENTLNQLLVEMDGFNTTTNVVVLAATNRVDILDKALLRPGRFDRQIFVPAPDIKGRASIFKVHLTPLKTTLNKENLARKMAALTPGFTGADIANVCNEAALIAARELANDITMKNFEQAIERVVAGMEKKSNVLQPDERKIVAYHEAGHAVAGWFLQHADPLLKVSIIPRGKGLGYAQYLPKEQYLYSKEQLFDRMCMTLGGRVSEEIFFGRITTGAQDDLKKITQSAYAQIVHYGMNAKVGNVSFEMPQPGEMVIDKPYSEKTAELIDSEVRDLINNAHKHTTDLLTKHKPNIEKVAERLLKQEILSRDDMIELLGPRPFPEKSTYEEFVEGTGSLDEDTTLPEGLKDWNKEKQPTTPPPETSPSSPTASKK

Summary

Similarity
Belongs to the AAA ATPase family.
EMBL
BABH01024905    KQ459167    KPJ03500.1    KQ460930    KPJ10714.1    JTDY01000656    + More
KOB76311.1    NWSH01001172    PCG72262.1    ODYU01011304    SOQ56958.1    GEDC01015800    JAS21498.1    KK853424    KDR07700.1    KK854089    PTY11078.1    NEVH01025136    PNF15813.1    GDKW01000249    JAI56346.1    ACPB03025706    GBGD01000502    JAC88387.1    GECL01003217    JAP02907.1    GFTR01008062    JAW08364.1    KQ971334    EEZ99702.1    GBBI01002393    JAC16319.1    GDAI01002878    JAI14725.1    GANO01001763    JAB58108.1    GBHO01011576    JAG32028.1    GBRD01010373    JAG55451.1    GAMC01003429    GAMC01003428    JAC03127.1    GDIP01165030    JAJ58372.1    GDIQ01171503    JAK80222.1    GDIQ01224384    JAK27341.1    GDIQ01118673    JAL33053.1    GDIQ01053855    JAN40882.1    GDIP01238628    JAI84773.1    GDIP01239724    JAI83677.1    GDIP01152481    JAJ70921.1    GDIP01037443    JAM66272.1    GDIP01252012    GDIP01195885    GDIP01080991    GDIP01045099    LRGB01000337    JAI71389.1    KZS19665.1    GDIP01070184    JAM33531.1    GDIP01165774    JAJ57628.1    GBXI01007447    JAD06845.1    GDIQ01177399    GDIQ01148729    GDIQ01140773    JAL10953.1    GDIQ01225590    JAK26135.1    GDIQ01208948    JAK42777.1    GDIP01194680    JAJ28722.1    GDIP01252011    GDIP01195884    GDIP01080990    GDIP01045098    JAI71390.1    GDIP01070237    JAM33478.1    GDIP01011123    JAM92592.1    GL732533    EFX85159.1    GDIQ01155608    JAK96117.1    GDIP01120583    JAL83131.1    GDIP01194679    JAJ28723.1    GDIP01169117    JAJ54285.1    GDHF01027841    GDHF01021403    GDHF01000967    GDHF01000154    JAI24473.1    JAI30911.1    JAI51347.1    JAI52160.1    GDIP01203575    JAJ19827.1    GDIQ01155609    JAK96116.1    CVRI01000054    CRL00090.1    GDIQ01038864    JAN55873.1    GDIP01165773    JAJ57629.1    GDIP01070183    JAM33532.1    GAKP01009730    GAKP01009729    JAC49223.1    LNIX01000021    OXA43808.1    GDHF01033218    JAI19096.1    GDIP01107135    JAL96579.1    GDIP01168314    GDIP01167610    JAJ55792.1    GDIP01254664    JAI68737.1    GDIP01107136    JAL96578.1    GDIP01217422    JAJ05980.1    JXUM01024012    JXUM01024013    JXUM01024014    JXUM01024015    KQ560677    KXJ81315.1    GDIP01118481    JAL85233.1    GGFM01007086    MBW27837.1    GGFM01002789    MBW23540.1    GDIP01039701    JAM64014.1    GGFJ01002104    MBW51245.1    CH477517    EAT39655.1    GBYB01002848    GBYB01002849    JAG72615.1    JAG72616.1    GGFJ01002110    MBW51251.1    APGK01026583    APGK01026584    KB740635    ENN79870.1    GL438129    EFN69522.1    GGFK01005362    MBW38683.1    GDIP01179280    JAJ44122.1    CM000159    EDW94750.1    JRES01001371    KNC23284.1    GFDF01011210    JAV02874.1    GGLE01006647    MBY10773.1    CH954178    EDV51992.1    GEFM01002918    JAP72878.1    ADMH02000528    ETN66093.1    AJWK01010543    AE014296    AY084199    AAF49365.2    AAL89937.1    CM000363    CM002912    EDX10825.1    KMZ00202.1    AAN11704.1    GEZM01013648    GEZM01013647    JAV92404.1    GFDF01011211    JAV02873.1    GFAC01005802    JAT93386.1    JH430221    GADI01001619    JAA72189.1    GFWV01022742    MAA47469.1   
Pfam
PF01434   Peptidase_M41        + More
PF06480   FtsH_ext
PF17862   AAA_lid_3
PF00004   AAA
Interpro
IPR003959   ATPase_AAA_core        + More
IPR000642   Peptidase_M41       
IPR037219   Peptidase_M41-like       
IPR011546   Pept_M41_FtsH_extracell       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR003593   AAA+_ATPase       
IPR041569   AAA_lid_3       
IPR005936   FtsH       
SUPFAM
SSF140990   SSF140990        + More
SSF52540   SSF52540       
Gene 3D
PDB
6NYY     E-value=0,     Score=2003

Ontologies

Topology

Length:
681
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
41.2392500000001
Exp number, first 60 AAs:
20.05883
Total prob of N-in:
0.00019
POSSIBLE N-term signal
sequence
outside
1  -  25
TMhelix
26  -  44
inside
45  -  127
TMhelix
128  -  150
outside
151  -  681
 
 

Population Genetic Test Statistics

Pi
224.211946
Theta
206.5491
Tajima's D
0.301478
CLR
359.59914
CSRT
0.451677416129194
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 FQDVAGCEEAK 100.00 7e-12
28556443 GGGLFGGVMESTAK 100.00 7e-12
28556443 NPQQYIDLGAK 100.00 1e-09
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号