SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03816
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106708942_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.053 Nuclear   Reliability : 1.603
 

Sequence

CDS
ATGACAGCTGCGCGTCATCCTAAAGACGATGGCCATCGAGGAGGTGACTCCGGTGGTTCCGGGGCCTGCTACGTCGGAAGACGCGATGCCCGCTCCCCACGGGACGAGACGTTCCGGGACCTCGACCTTGCACTGGTCAATTTGGGCAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAACGGCTCCGGGAGGCAGCCGCTATGGTGAGAACAAGGCTGATCCCCACCATGTCCAAGCTTTATGACTTGGTAGAGAGCCGAGAGGTGGAGAGCAAAGATCTTGTCGCTCATTGTGACTCCAGAGAGAGTCGCATCTCGGGAGATACCCCGGCCTTGCGGGGAGGGACTCCCCTGTTGCCGAGGCCGCCGCTGGCACGCTCTGGCCCCCCCGCGGGAGCGATGGATATTGACGTGCACTTGCGCTCCGCTGTGAGTGTGACGGCGCAAATGCCAGAGCCCAATCCTGTGGCCCCTGTCCCGCTAGCGCCTAGCCCCGCGCTCCCTCGCCCTCCACGTAGGGTCGAGTTAAGGCCTGCGCCGCCTCCGCGGATATCGGCCGCCCCTGCGTCTACACGGAGAGGAAGGCTAAGCCCTGCGCCAGCGCGGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCGGCACTACCGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTTGCAGGCTCGCGGGCCACACAACACGGCTGCTGGGATGGTAGAGGTGGACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGTATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGTTCCTCGATTGGTTCCGGAGACTGCATCCCGGCGCCAACAGCCGCAGCCACCCCGCGGAGCCAGGCCGCCCGGCTGACCTCTGCCCCCACTCCATCCGCGAGGTTGGCACGGCGTAGAGGCCGGGACCAAAACAACAAGGGTACGGGTGCCCAGAATCCTGCCCCAAAATCCCAACCCCGTCCCCTTCCTGCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGCAAGGCAGCAGACAGCGGCTCTGGCAGCTCCCAGAGGGGGTCGAGCGCCGACCGCTGCAGCACGAAGCACAGAGCTGGCGGCCGTAGCTGCTCCTCGTGAGAATCGAGCACTGGCAGCCAGGAAGAAGAATGGCAAAAAGAAGAGGGCGCGCGCAGCGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCGGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGGGCGCGCGCGGCCGTAAGTTTGGATGAAATCGGGGCAGAGGAGGGCCTCCGCTTCCGGCACACAGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCACTGCCGGAGGATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGAATCACCGGCCTGGACGACTGTGCTACCAAGGAGGAGGTGGCAGCCGCGATAGCCGCCCAAGGTGGATGTGCCCTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCTGGAGCCAGGTCGGTGTGGGCGCGCTGCCCTGTGGAGGCAGCCACTTCCTTGGCCACTCCTCCGCCGGGAAGATCGACGGGGGACCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGTCTCCGATGTTTTAGCACCGGGCACGGCCTCGCTAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCACAGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGCCGAAAATCAAAGCGCCGACAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGATGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGTGAAGGGGAGGGGGCGATGGATGTGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATATGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCTGGCGATGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGCACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGCGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTAGACTCCCTAATCGCCAAGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTTTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCCCCGCATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAAGACACTGCACCCGGCCCGGACGGCGTGCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCCGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCTCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGAAGGGCGCTGGAACGGCACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGATGACCCCCTTTTGTGGAATATCGGGTATGACTGGGTACTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGGCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCGTGGCGCGTCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAGTAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MTAARHPKDDGHRGGDSGGSGACYVGRRDARSPRDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVRTRLIPTMSKLYDLVESREVESKDLVAHCDSRESRISGDTPALRGGTPLLPRPPLARSGPPAGAMDIDVHLRSAVSVTAQMPEPNPVAPVPLAPSPALPRPPRRVELRPAPPPRISAAPASTRRGRLSPAPARAEDIRSPLARMVDEWPALPPPLSPSRAAGLQARGPHNTAAGMVEVDSLPSREEMVACISRAVAVEVGKHFAGLEEMLRSSIGSGDCIPAPTAAATPRSQAARLTSAPTPSARLARRRGRDQNNKGTGAQNPAPKSQPRPLPAPPSSMDEGWTEVVKRGKKARQQTAALAAPRGGRAPTAAARSTELAAVAAPRENRALAARKKNGKKKRARAARSAAVVVTLLPAAAEKGLTYNEVMARARAAVSLDEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEDEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSVWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGDNTERNRRRKSKRRQKRRLARGALANAVIPDAAPVPEGGGSGEGEGAMDVDMLSQSMAEWSIDMAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPWRCDSRGGPQCEVCRMGLPRSDARGRLLERWAHAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKALLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFFAPAMDAPPEYDGEVPAEVPRITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGRALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLDDPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVGGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARGVARPSHSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKVGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00227449,     Score=103

Ontologies

Topology

Length:
1712
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13812
Exp number, first 60 AAs:
0.00609
Total prob of N-in:
0.00251
outside
1  -  1712
 
 

Population Genetic Test Statistics

Pi
162.071791
Theta
182.284438
Tajima's D
3.902075
CLR
504.637013
CSRT
0.998400079996
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号