SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03797
Pre Gene Modal
BGIBMGA014330
Annotation
endonuclease-reverse_transcriptase_HmRTE-e01_[Danaus_plexippus]
Location in the cell
Cytoplasmic   Reliability : 1.433 Mitochondrial   Reliability : 1.108 Nuclear   Reliability : 1.596
 

Sequence

CDS
ATGAGAAGGAATAAAAAGAAGAGCACCAGGGCTAGGGCGTCCCCCGCAGGCGACGCGCAGGGACAGCACCCGGTCTCTGTGGAAAGTGGACGAGGGTTGTCGCATCACGGGCGGGTGCGACGTAAGACGCAAGCCCAAAATGTGAGAGAGATGAGATTGAGGTATGCAAGCTGGAATGTGGGCAGTATGACTGGGAAAGGAAGGGAGCTAGTAGATGTGTTAAAGAGGAGAAGAATAAATATAGCATGTCTGCAAGAGACTAGGTGGAAAGGAGCGAAAGCTAGAGAAATTGGTGAAGGATATAAGCTGTATTATAGTGGAAGTGATGGAAGAAGGAATGGCGTGGGAGTAGTGTTAGATAAGGATTTGAAAGATTGTGTGGCGCATGTCATAAGAACGAGTGATAGGATAATAACCGTAAAAATAGTTTGTGAAAGTGTTATTTTGAATGTTATAAGTGTGTACGCGCCTCAGTCCGGGTGCAAGGAGGACGTGAAAGAAAAATTTTGGCAGGATTTTGATAGTGTTATGATTCGCATTCCAGAGAGTGAAGAGATTTGTATAGGAGGTGATTTTAATGGACATGTAGGAGCTACAAATGAGGGCTATGAAAGGGTGCATGGAGGGTGGGGGTATGGCAATCGTAATGATGATGGAGACCAGTTGCTCCAAGCTGCGACTACCTCTAACCTGGCAGTTGCGAATACGTGGTTCCAGAAACGGCCTGAACACCTTATCACCTATAAGAGTGGTAATCACGCGACACAGATCGACTACTTTCTGATTAAGAGAAGTAAGTTGGTCTGTGTCAAAAACTGCAAAGTACTGCCGGGTGAAGCATTGGTGACGCAGCATAGACTGCTACTAATGGACATTACAATCAGTTACAAGTACCTAAGGAGAAAAAACCGTCTCTCGCCAAAAATTAGATGGCGTATGCTAGAGACAGATGAGTATGCTGGTCGATTTAGGGAAATAATGGTAGAAAACATCTTGGAAATGAAGGATATGAAAGAGAAATCTGCGAATGATTGTTGGGATGAAATGGCAAATAGTGTCAGGAAGACAGCTAAGGCTGTGCTCGGCGAATCAAAAGGGAAAGGTATAATTGACAAGGATACATGGTGGTGGAATGAGAATGTACAGAGAGAATTGAAAGAAAAGAAGAATGCATTCAAAAAGTGGCAACTAGAAAGAGGTAATGAAAGTGAGAGGCAAGCTAGGAAGAATGAGTATAGAGAATGTAAGAAAAAGGCCACTAAAGCGGTTGCTATAGCCAGGTCTGACGCTCAGAAACGGTTGTATGCCGCTTTAGATGGACCTCGTGGACAAAAGGAACTTTACCGTATTACAAGAGCTAGAGAAGAAAGAGCGATATTAAGCATGTCAGATGAGAACGACTGGAATAGAGTGATTAATAGGAAGCCAGAGAACGTCGGACTTGTGAATGAGATTAGTATGTATGAAGTTAGAGAAGCAGTGAGAAGTATGAAAAGCGGAAAATCGGAAGGACCAGACGGTATACCAGTGGAAGTATGGAAGATACTGGGAGAAGACGGATATAAGTGGCTGACTTTATTCTTCAATAAGCTGCTGCAAGAAGAAGTGATCCCTACGGAATGGAGCATCAGTACGCTGGTGCCCATATACAAAAATAAAGGGGATGTGCAAGACTGTGGCAGCTATCGGGGAATAAAGCTTATGTCTCATAGTATGAAAGTTTGGGAGAAAGTGATAGAAAAGCGATTGCGAGATGAAAGTGAGATCACCCAAAACCAGTTCGGGTTCATGCCTGGTCGCGGGACAACGGACGCCATATTTGCACTACGCCAAGTGTGCGAAAAACATCGCGACGTGCACAGGAATCTGCATATGGTGTTCGTTGATCTAGAAAAAGCGTACGACCGAGTACCTAGAGCAGTTTTGTGGTGGGCATTGAATGAGAAAGGTATACCTGGTAAGTATGTGAGGTTAATCTGTGCCATGTACAGTCGAGCCAGGACGTATGTACGAACCGCCGCGGGGAATTCCGACGAGTTCAGTGTGGCAGTGGGCTTACACCAAGGGTCTGCACTAAGTCCCTATCTCTTCCTGCTTGTGATGGATGCCTTGACATCGGAGATACAGGAAGAGCCCCCTTGGTGTATGCTGTTTGCCGATGACATAGTGCTCGTCGGAGAAAACGGGCTCGAGGTCCAAAACATACTGGAGAAATGGCGATGCAAGTTGGAGAGTGTTGGCCTAAAAATCAGCAGATCGAAAACCGAACATCTGTTCTGTGATTTTGGCGGTCTCTCCAATTTTACACCCATTTCCCTCGACGGAACACCTTTGCCAGTATGTCAAGACTTCCGATACCTAGGGTCTGTTATCCAAAGCGACGGTGAACTGGATCGTACTGTGAGGCACAGAATTGACGCAGGATGGATGAAATGGCGGCAGGTCACGGGCACCATATGTGACTCGCACATCCCTCTTCCCCTAAAAGGGAAGATATATAAGACCTTAATAAGGCCTGCCGTCTTGTATGGATCAGCTTGTTGGACAACGAAAGTGGCGGATGAAAGGCGATTGCATGCAGCAGAGATGCGAATGTTGCGATGGATGTGTGGAGTAACGAGAATGGATAGAATACGGAATGAATATGTTAGAGGAAGTCTGAAAGTGGCACCTGTGACAGAGAAGCTGAGGAGTGCACGTTTGGGATGGTATGGACATGTGATGAGACGGAATGAAAATGAGGTTGTTAAGAGAGTGTTAACTATGAATGTGGAAGGATTTAGAGGAAGAGGTAGACCTAAGAAGAAATGA
Protein
MRRNKKKSTRARASPAGDAQGQHPVSVESGRGLSHHGRVRRKTQAQNVREMRLRYASWNVGSMTGKGRELVDVLKRRRINIACLQETRWKGAKAREIGEGYKLYYSGSDGRRNGVGVVLDKDLKDCVAHVIRTSDRIITVKIVCESVILNVISVYAPQSGCKEDVKEKFWQDFDSVMIRIPESEEICIGGDFNGHVGATNEGYERVHGGWGYGNRNDDGDQLLQAATTSNLAVANTWFQKRPEHLITYKSGNHATQIDYFLIKRSKLVCVKNCKVLPGEALVTQHRLLLMDITISYKYLRRKNRLSPKIRWRMLETDEYAGRFREIMVENILEMKDMKEKSANDCWDEMANSVRKTAKAVLGESKGKGIIDKDTWWWNENVQRELKEKKNAFKKWQLERGNESERQARKNEYRECKKKATKAVAIARSDAQKRLYAALDGPRGQKELYRITRAREERAILSMSDENDWNRVINRKPENVGLVNEISMYEVREAVRSMKSGKSEGPDGIPVEVWKILGEDGYKWLTLFFNKLLQEEVIPTEWSISTLVPIYKNKGDVQDCGSYRGIKLMSHSMKVWEKVIEKRLRDESEITQNQFGFMPGRGTTDAIFALRQVCEKHRDVHRNLHMVFVDLEKAYDRVPRAVLWWALNEKGIPGKYVRLICAMYSRARTYVRTAAGNSDEFSVAVGLHQGSALSPYLFLLVMDALTSEIQEEPPWCMLFADDIVLVGENGLEVQNILEKWRCKLESVGLKISRSKTEHLFCDFGGLSNFTPISLDGTPLPVCQDFRYLGSVIQSDGELDRTVRHRIDAGWMKWRQVTGTICDSHIPLPLKGKIYKTLIRPAVLYGSACWTTKVADERRLHAAEMRMLRWMCGVTRMDRIRNEYVRGSLKVAPVTEKLRSARLGWYGHVMRRNENEVVKRVLTMNVEGFRGRGRPKKK

Summary

Uniprot
A0A2A4IZ11   A0A445J0R5   C6Y4D5   A0A445G8Y2   A0A445LEB4   A0A445FNJ6   + More
A0A445F6Z2   A0A445G8F3   A0A1D6FJU8   A0A1D6M7A6   A0A3L6FAM2   A0A1D6P0V1   A0A1D6K3M7   A0A3L6FHK1   A0A1D6JQ10   A0A1D6HX90   A0A1D6KLY6   A0A3L6GA57   A0A1D6JJN9   A0A1D6I351   A0A445I5D1   A0A1D6I7A1   A0A3L6EF28   A0A3L6DTJ3   A0A1D6LXZ4   A0A1D6G503   A0A445I5C8   A0A1D6I607   A0A445I5E3   A0A1D6KVT7   A0A1D6MV72   A0A1D6J5H5   A0A1D6NCE0   A0A1D6LFI2   A0A445L940   A0A1D6GRX4   A0A3L6G913   A0A1D6PU65   A0A445G821   A0A1D6HE72   A0A445FDA8   A0A3B3C7H7   A0A317YB76   A0A3B3BTI6   A0A3B3CQH3   A0A3B3CTC7   A0A3B3CPF5   A0A3B3E183   A0A3B3BT53   A0A3B3HS69   A0A3B3BC11   A0A0V0IX54   A0A1D6MYV7   A0A3B3CCF8   A0A3Q1I6K9   A0A3B3IEV4   A0A3P9KU10   A0A3B3BH81   A0A3B3BQU5   A0A3P9KEZ0   A0A3B3IC09   A0A3P9M4S0   A0A3P9M3S5   A0A3B3HT45   A0A3B3HJZ3   A0A3Q1JCX2   A0A3P9J281   A0A3B3HKV3   A0A3B3HPV6   A0A3P9H708   A0A3P9MAU2   A0A3B3CWT9   A0A3Q1HIZ5   A0A3B3CWZ8   A0A3B3HQW9   A0A3B3H3Q1   A0A3B3HY61   A0A3B3HLA9   A0A3B3HQU7   A0A3B3IM62   A0A3P9K1J1   A0A3B3HEZ2   A0A3P9K813   A0A3B3H5C8   A0A3B3C2Z2   A0A3P9LQU2   A0A3P9MI82   A0A3B3HFD6   A0A3B3IP13   A0A3P9M241   A0A317Y8S7   A0A1D6KWI6   A0A3Q1HXD9   A0A3B3HUW2   A0A3P9HVA4   A0A3B3ILX4   A0A3P9JFB7   A0A3B3HV05   A0A3B3HVG5   A0A3P9JXW8  
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF01501   Glyco_transf_8
PF04832   SOUL
PF00005   ABC_tran
PF00226   DnaJ
PF14529   Exo_endo_phos_2
PF07727   RVT_2
PF10607   CLTH
PF04937   DUF659
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002495   Glyco_trans_8       
IPR029044   Nucleotide-diphossugar_trans       
IPR027124   Swc5/CFDP2       
IPR011256   Reg_factor_effector_dom_sf       
IPR006917   SOUL_haem-bd       
IPR036565   Mur-like_cat_sf       
IPR001645   Folylpolyglutamate_synth       
IPR018109   Folylpolyglutamate_synth_CS       
IPR036615   Mur_ligase_C_dom_sf       
IPR003593   AAA+_ATPase       
IPR017871   ABC_transporter_CS       
IPR003439   ABC_transporter-like       
IPR027417   P-loop_NTPase       
IPR036869   J_dom_sf       
IPR018253   DnaJ_domain_CS       
IPR001623   DnaJ_domain       
IPR003323   OTU_dom       
IPR013103   RVT_2       
IPR038765   Papain-like_cys_pep_sf       
IPR024964   CTLH/CRA       
IPR006595   CTLH_C       
IPR007021   DUF659       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53448   SSF53448       
SSF55136   SSF55136       
SSF53623   SSF53623       
SSF53244   SSF53244       
SSF52540   SSF52540       
SSF46565   SSF46565       
SSF54001   SSF54001       
SSF53098   SSF53098       
ProteinModelPortal
A0A2A4IZ11   A0A445J0R5   C6Y4D5   A0A445G8Y2   A0A445LEB4   A0A445FNJ6   + More
A0A445F6Z2   A0A445G8F3   A0A1D6FJU8   A0A1D6M7A6   A0A3L6FAM2   A0A1D6P0V1   A0A1D6K3M7   A0A3L6FHK1   A0A1D6JQ10   A0A1D6HX90   A0A1D6KLY6   A0A3L6GA57   A0A1D6JJN9   A0A1D6I351   A0A445I5D1   A0A1D6I7A1   A0A3L6EF28   A0A3L6DTJ3   A0A1D6LXZ4   A0A1D6G503   A0A445I5C8   A0A1D6I607   A0A445I5E3   A0A1D6KVT7   A0A1D6MV72   A0A1D6J5H5   A0A1D6NCE0   A0A1D6LFI2   A0A445L940   A0A1D6GRX4   A0A3L6G913   A0A1D6PU65   A0A445G821   A0A1D6HE72   A0A445FDA8   A0A3B3C7H7   A0A317YB76   A0A3B3BTI6   A0A3B3CQH3   A0A3B3CTC7   A0A3B3CPF5   A0A3B3E183   A0A3B3BT53   A0A3B3HS69   A0A3B3BC11   A0A0V0IX54   A0A1D6MYV7   A0A3B3CCF8   A0A3Q1I6K9   A0A3B3IEV4   A0A3P9KU10   A0A3B3BH81   A0A3B3BQU5   A0A3P9KEZ0   A0A3B3IC09   A0A3P9M4S0   A0A3P9M3S5   A0A3B3HT45   A0A3B3HJZ3   A0A3Q1JCX2   A0A3P9J281   A0A3B3HKV3   A0A3B3HPV6   A0A3P9H708   A0A3P9MAU2   A0A3B3CWT9   A0A3Q1HIZ5   A0A3B3CWZ8   A0A3B3HQW9   A0A3B3H3Q1   A0A3B3HY61   A0A3B3HLA9   A0A3B3HQU7   A0A3B3IM62   A0A3P9K1J1   A0A3B3HEZ2   A0A3P9K813   A0A3B3H5C8   A0A3B3C2Z2   A0A3P9LQU2   A0A3P9MI82   A0A3B3HFD6   A0A3B3IP13   A0A3P9M241   A0A317Y8S7   A0A1D6KWI6   A0A3Q1HXD9   A0A3B3HUW2   A0A3P9HVA4   A0A3B3ILX4   A0A3P9JFB7   A0A3B3HV05   A0A3B3HVG5   A0A3P9JXW8  
PDB
2VOA     E-value=0.000537209,     Score=106

Ontologies

Topology

Length:
936
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.18849
Exp number, first 60 AAs:
0.00256
Total prob of N-in:
0.05731
outside
1  -  936
 
 

Population Genetic Test Statistics

Pi
194.821726
Theta
189.429443
Tajima's D
0.557933
CLR
0.42936
CSRT
0.532373381330933
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号